Incidental Mutation 'R4406:Ly75'
ID327646
Institutional Source Beutler Lab
Gene Symbol Ly75
Ensembl Gene ENSMUSG00000026980
Gene Namelymphocyte antigen 75
SynonymsDEC-205, CD205
MMRRC Submission 041688-MU
Accession Numbers

Genbank: NM_013825

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4406 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location60292103-60383303 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60354550 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 420 (E420G)
Ref Sequence ENSEMBL: ENSMUSP00000028362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028362] [ENSMUST00000112533]
Predicted Effect probably damaging
Transcript: ENSMUST00000028362
AA Change: E420G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028362
Gene: ENSMUSG00000026980
AA Change: E420G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
RICIN 33 146 2.63e-17 SMART
FN2 162 209 1.22e-23 SMART
CLECT 216 341 7.36e-32 SMART
CLECT 361 486 9.28e-29 SMART
CLECT 501 624 1.11e-17 SMART
CLECT 643 791 1.93e-26 SMART
CLECT 811 932 7.94e-2 SMART
CLECT 952 1091 5.81e-21 SMART
CLECT 1104 1222 1.04e-22 SMART
CLECT 1240 1382 3.48e-10 SMART
CLECT 1395 1513 9.59e-22 SMART
CLECT 1530 1661 7.79e-22 SMART
transmembrane domain 1670 1692 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112533
AA Change: E420G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108152
Gene: ENSMUSG00000026980
AA Change: E420G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
RICIN 33 146 2.63e-17 SMART
FN2 162 209 1.22e-23 SMART
CLECT 216 341 7.36e-32 SMART
CLECT 361 486 9.28e-29 SMART
CLECT 501 624 1.11e-17 SMART
CLECT 643 791 1.93e-26 SMART
CLECT 811 932 7.94e-2 SMART
CLECT 952 1091 5.81e-21 SMART
CLECT 1104 1222 1.04e-22 SMART
CLECT 1240 1382 3.48e-10 SMART
CLECT 1395 1513 9.59e-22 SMART
CLECT 1530 1661 7.79e-22 SMART
transmembrane domain 1670 1692 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124654
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151984
Meta Mutation Damage Score 0.6178 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (45/45)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display abnormalities in CD8-positive T cell morphology and cytotoxic T cell physiology. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(5)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca C T 11: 84,280,449 L1170F probably benign Het
Acss3 A T 10: 107,053,337 D207E probably damaging Het
Adgrl1 T C 8: 83,930,042 S325P probably damaging Het
Ankrd37 A G 8: 45,997,094 probably benign Het
Atp13a2 C T 4: 141,006,476 P1059S probably damaging Het
Camkv T C 9: 107,946,219 probably null Het
Ces1f T C 8: 93,263,322 T387A probably benign Het
Dmxl1 T A 18: 49,889,553 L1653I probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fat2 G A 11: 55,262,268 A3706V probably benign Het
Fbln1 T A 15: 85,231,556 probably null Het
Gm1527 G A 3: 28,895,725 V45M possibly damaging Het
Gm5084 A G 13: 60,212,566 noncoding transcript Het
Itpr1 T A 6: 108,354,663 H194Q probably damaging Het
Kif24 A T 4: 41,393,954 L973Q probably damaging Het
Lrfn4 T C 19: 4,613,271 T412A probably benign Het
Map3k12 T C 15: 102,505,402 T45A probably damaging Het
Mib1 A C 18: 10,763,289 K446N probably damaging Het
Mrpl4 T C 9: 21,006,935 W146R probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Nomo1 A G 7: 46,056,668 N482S probably benign Het
Olfr1385 G A 11: 49,494,917 R128H probably benign Het
Olfr1411 T A 1: 92,597,314 M265K possibly damaging Het
Olfr1446 A T 19: 12,890,234 Y114* probably null Het
Olfr1458 A G 19: 13,102,594 S237P possibly damaging Het
Olfr935 T C 9: 38,994,569 I289V possibly damaging Het
Osbpl10 C T 9: 115,109,481 H70Y probably damaging Het
Pdilt A C 7: 119,495,009 S340A probably damaging Het
Ppan C A 9: 20,890,992 D226E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sema3g G A 14: 31,228,159 V766M probably benign Het
Skint6 T A 4: 113,156,486 N356I probably benign Het
Slco2b1 A T 7: 99,664,889 S496T probably benign Het
Trak1 T C 9: 121,431,536 V11A probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Umod G A 7: 119,466,064 P581S probably damaging Het
Zfat A G 15: 68,180,191 S585P probably benign Het
Zfp472 C A 17: 32,978,160 T403N probably benign Het
Zfp936 A G 7: 43,190,324 Q405R possibly damaging Het
Other mutations in Ly75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Ly75 APN 2 60376077 missense probably damaging 1.00
IGL01072:Ly75 APN 2 60354496 missense probably damaging 1.00
IGL01409:Ly75 APN 2 60321692 splice site probably null
IGL01432:Ly75 APN 2 60376007 missense probably damaging 1.00
IGL01626:Ly75 APN 2 60301015 missense probably benign 0.13
IGL01690:Ly75 APN 2 60338311 missense probably damaging 1.00
IGL01862:Ly75 APN 2 60299172 missense probably damaging 1.00
IGL01982:Ly75 APN 2 60311764 missense probably damaging 1.00
IGL02075:Ly75 APN 2 60352356 missense probably damaging 0.99
IGL02338:Ly75 APN 2 60354452 missense probably benign 0.04
IGL02364:Ly75 APN 2 60358507 missense probably damaging 1.00
IGL02456:Ly75 APN 2 60293781 missense probably benign 0.09
IGL02474:Ly75 APN 2 60383182 missense probably null 1.00
IGL02608:Ly75 APN 2 60321900 missense probably benign 0.41
IGL02986:Ly75 APN 2 60308191 missense probably damaging 1.00
IGL03015:Ly75 APN 2 60376160 missense probably damaging 1.00
IGL03049:Ly75 APN 2 60352070 missense probably damaging 0.99
euphues UTSW 2 60299045 critical splice donor site probably null
four_score UTSW 2 60311771 missense possibly damaging 0.75
lyly UTSW 2 60327873 missense possibly damaging 0.49
Witty UTSW 2 60354500 missense probably damaging 1.00
D605:Ly75 UTSW 2 60352352 critical splice donor site probably null
R0046:Ly75 UTSW 2 60339457 intron probably benign
R0055:Ly75 UTSW 2 60321918 missense probably benign 0.01
R0055:Ly75 UTSW 2 60321918 missense probably benign 0.01
R0071:Ly75 UTSW 2 60321819 missense probably benign 0.01
R0071:Ly75 UTSW 2 60321819 missense probably benign 0.01
R0285:Ly75 UTSW 2 60318319 missense probably damaging 1.00
R0387:Ly75 UTSW 2 60306404 missense probably benign 0.20
R0492:Ly75 UTSW 2 60308276 missense probably damaging 1.00
R0688:Ly75 UTSW 2 60316221 missense probably benign 0.41
R1367:Ly75 UTSW 2 60293758 unclassified probably null
R1463:Ly75 UTSW 2 60368757 critical splice donor site probably null
R1581:Ly75 UTSW 2 60327893 missense probably damaging 1.00
R1663:Ly75 UTSW 2 60314234 missense probably damaging 1.00
R1818:Ly75 UTSW 2 60311777 missense probably damaging 1.00
R1881:Ly75 UTSW 2 60349940 missense probably benign 0.00
R2244:Ly75 UTSW 2 60349913 missense probably benign 0.01
R2905:Ly75 UTSW 2 60334554 missense probably benign 0.00
R3967:Ly75 UTSW 2 60327873 missense possibly damaging 0.49
R3968:Ly75 UTSW 2 60327873 missense possibly damaging 0.49
R4039:Ly75 UTSW 2 60352995 missense probably damaging 1.00
R4526:Ly75 UTSW 2 60330773 missense probably benign 0.09
R4647:Ly75 UTSW 2 60308278 missense probably damaging 1.00
R4795:Ly75 UTSW 2 60349940 missense probably benign 0.00
R4796:Ly75 UTSW 2 60349940 missense probably benign 0.00
R4962:Ly75 UTSW 2 60352125 missense probably damaging 1.00
R4979:Ly75 UTSW 2 60375894 missense probably damaging 1.00
R5072:Ly75 UTSW 2 60375963 missense probably damaging 1.00
R5288:Ly75 UTSW 2 60303641 missense probably damaging 1.00
R5373:Ly75 UTSW 2 60311771 missense possibly damaging 0.75
R5374:Ly75 UTSW 2 60311771 missense possibly damaging 0.75
R5384:Ly75 UTSW 2 60334487 nonsense probably null
R5385:Ly75 UTSW 2 60303641 missense probably damaging 1.00
R5395:Ly75 UTSW 2 60365111 missense probably benign 0.41
R5531:Ly75 UTSW 2 60365145 missense probably damaging 0.98
R5662:Ly75 UTSW 2 60352381 missense probably damaging 1.00
R5667:Ly75 UTSW 2 60308311 missense probably damaging 1.00
R5668:Ly75 UTSW 2 60354500 missense probably damaging 1.00
R5671:Ly75 UTSW 2 60308311 missense probably damaging 1.00
R5677:Ly75 UTSW 2 60299082 missense probably benign 0.00
R5764:Ly75 UTSW 2 60318439 missense probably benign
R5896:Ly75 UTSW 2 60383146 missense probably benign
R6025:Ly75 UTSW 2 60375962 missense probably damaging 1.00
R6113:Ly75 UTSW 2 60368873 missense probably benign 0.04
R6448:Ly75 UTSW 2 60299045 critical splice donor site probably null
R6601:Ly75 UTSW 2 60318376 missense probably benign 0.11
R6745:Ly75 UTSW 2 60308179 missense probably damaging 1.00
R6955:Ly75 UTSW 2 60327873 missense possibly damaging 0.49
R6960:Ly75 UTSW 2 60306405 missense probably benign
R7100:Ly75 UTSW 2 60306434 missense probably benign
R7110:Ly75 UTSW 2 60376184 missense probably benign 0.31
R7203:Ly75 UTSW 2 60323852 nonsense probably null
R7291:Ly75 UTSW 2 60329993 missense probably damaging 0.98
R7308:Ly75 UTSW 2 60334515 missense probably benign 0.04
R7447:Ly75 UTSW 2 60334474 nonsense probably null
R7512:Ly75 UTSW 2 60334563 missense probably damaging 1.00
R7595:Ly75 UTSW 2 60293827 missense probably benign 0.01
R8005:Ly75 UTSW 2 60332934 missense probably damaging 1.00
X0025:Ly75 UTSW 2 60354475 missense probably damaging 1.00
Z1177:Ly75 UTSW 2 60350004 nonsense probably null
Z1177:Ly75 UTSW 2 60352133 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TGACAACCTACGGGATGTTACC -3'
(R):5'- GTATGAGGGGCATTACAGGC -3'

Sequencing Primer
(F):5'- GACAACCTACGGGATGTTACCTTTTC -3'
(R):5'- ATTACAGGCCTGGCGACC -3'
Posted On2015-07-07