Incidental Mutation 'R4406:Nomo1'
ID327656
Institutional Source Beutler Lab
Gene Symbol Nomo1
Ensembl Gene ENSMUSG00000030835
Gene Namenodal modulator 1
SynonymsPM5, D7Ertd156e, Nomo
MMRRC Submission 041688-MU
Accession Numbers

NCBI RefSeq: NM_153057.4; MGI: 2385850

Is this an essential gene? Possibly essential (E-score: 0.678) question?
Stock #R4406 (G1)
Quality Score212
Status Validated
Chromosome7
Chromosomal Location46033698-46084212 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46056668 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 482 (N482S)
Ref Sequence ENSEMBL: ENSMUSP00000033121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033121]
Predicted Effect probably benign
Transcript: ENSMUST00000033121
AA Change: N482S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000033121
Gene: ENSMUSG00000030835
AA Change: N482S

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
internal_repeat_1 22 215 2.35e-7 PROSPERO
Pfam:CarboxypepD_reg 322 395 3.5e-12 PFAM
Pfam:DUF2012 331 401 5.7e-10 PFAM
low complexity region 709 732 N/A INTRINSIC
low complexity region 881 893 N/A INTRINSIC
Blast:FN3 913 1017 6e-22 BLAST
low complexity region 1156 1164 N/A INTRINSIC
low complexity region 1203 1214 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182842
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (45/45)
Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca C T 11: 84,280,449 L1170F probably benign Het
Acss3 A T 10: 107,053,337 D207E probably damaging Het
Adgrl1 T C 8: 83,930,042 S325P probably damaging Het
Ankrd37 A G 8: 45,997,094 probably benign Het
Atp13a2 C T 4: 141,006,476 P1059S probably damaging Het
Camkv T C 9: 107,946,219 probably null Het
Ces1f T C 8: 93,263,322 T387A probably benign Het
Dmxl1 T A 18: 49,889,553 L1653I probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fat2 G A 11: 55,262,268 A3706V probably benign Het
Fbln1 T A 15: 85,231,556 probably null Het
Gm1527 G A 3: 28,895,725 V45M possibly damaging Het
Gm5084 A G 13: 60,212,566 noncoding transcript Het
Itpr1 T A 6: 108,354,663 H194Q probably damaging Het
Kif24 A T 4: 41,393,954 L973Q probably damaging Het
Lrfn4 T C 19: 4,613,271 T412A probably benign Het
Ly75 T C 2: 60,354,550 E420G probably damaging Het
Map3k12 T C 15: 102,505,402 T45A probably damaging Het
Mib1 A C 18: 10,763,289 K446N probably damaging Het
Mrpl4 T C 9: 21,006,935 W146R probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Olfr1385 G A 11: 49,494,917 R128H probably benign Het
Olfr1411 T A 1: 92,597,314 M265K possibly damaging Het
Olfr1446 A T 19: 12,890,234 Y114* probably null Het
Olfr1458 A G 19: 13,102,594 S237P possibly damaging Het
Olfr935 T C 9: 38,994,569 I289V possibly damaging Het
Osbpl10 C T 9: 115,109,481 H70Y probably damaging Het
Pdilt A C 7: 119,495,009 S340A probably damaging Het
Ppan C A 9: 20,890,992 D226E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sema3g G A 14: 31,228,159 V766M probably benign Het
Skint6 T A 4: 113,156,486 N356I probably benign Het
Slco2b1 A T 7: 99,664,889 S496T probably benign Het
Trak1 T C 9: 121,431,536 V11A probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Umod G A 7: 119,466,064 P581S probably damaging Het
Zfat A G 15: 68,180,191 S585P probably benign Het
Zfp472 C A 17: 32,978,160 T403N probably benign Het
Zfp936 A G 7: 43,190,324 Q405R possibly damaging Het
Other mutations in Nomo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Nomo1 APN 7 46045336 missense possibly damaging 0.66
IGL00811:Nomo1 APN 7 46083308 missense possibly damaging 0.95
IGL01710:Nomo1 APN 7 46038556 missense probably damaging 1.00
IGL01797:Nomo1 APN 7 46056662 missense probably damaging 0.96
IGL01973:Nomo1 APN 7 46083227 splice site probably benign
IGL02506:Nomo1 APN 7 46078056 missense possibly damaging 0.50
IGL02739:Nomo1 APN 7 46044307 splice site probably null
IGL02863:Nomo1 APN 7 46046916 missense probably damaging 0.98
P0005:Nomo1 UTSW 7 46037557 critical splice acceptor site probably null
PIT4243001:Nomo1 UTSW 7 46044281 missense probably damaging 1.00
R0106:Nomo1 UTSW 7 46037632 missense probably damaging 1.00
R0106:Nomo1 UTSW 7 46037632 missense probably damaging 1.00
R0124:Nomo1 UTSW 7 46083228 splice site probably benign
R0239:Nomo1 UTSW 7 46079594 critical splice donor site probably null
R0239:Nomo1 UTSW 7 46079594 critical splice donor site probably null
R0417:Nomo1 UTSW 7 46068698 missense possibly damaging 0.51
R0467:Nomo1 UTSW 7 46072487 splice site probably null
R0535:Nomo1 UTSW 7 46072517 missense probably damaging 0.99
R0829:Nomo1 UTSW 7 46076172 splice site probably benign
R0940:Nomo1 UTSW 7 46033905 missense possibly damaging 0.56
R1480:Nomo1 UTSW 7 46060913 missense probably damaging 0.98
R1601:Nomo1 UTSW 7 46046955 missense probably damaging 0.96
R1743:Nomo1 UTSW 7 46070037 critical splice donor site probably null
R1765:Nomo1 UTSW 7 46066293 missense possibly damaging 0.59
R1861:Nomo1 UTSW 7 46078101 missense probably benign 0.06
R1998:Nomo1 UTSW 7 46033944 missense possibly damaging 0.69
R1999:Nomo1 UTSW 7 46056727 missense possibly damaging 0.95
R2145:Nomo1 UTSW 7 46066504 missense probably damaging 1.00
R2869:Nomo1 UTSW 7 46046937 missense probably damaging 0.96
R2869:Nomo1 UTSW 7 46046937 missense probably damaging 0.96
R2870:Nomo1 UTSW 7 46046937 missense probably damaging 0.96
R2870:Nomo1 UTSW 7 46046937 missense probably damaging 0.96
R2871:Nomo1 UTSW 7 46046937 missense probably damaging 0.96
R2871:Nomo1 UTSW 7 46046937 missense probably damaging 0.96
R2873:Nomo1 UTSW 7 46046937 missense probably damaging 0.96
R4116:Nomo1 UTSW 7 46033896 missense probably benign 0.06
R4404:Nomo1 UTSW 7 46056668 missense probably benign 0.00
R4560:Nomo1 UTSW 7 46041480 missense probably damaging 0.99
R4633:Nomo1 UTSW 7 46050260 splice site probably benign
R4651:Nomo1 UTSW 7 46068442 missense probably damaging 0.99
R4653:Nomo1 UTSW 7 46061813 missense probably benign 0.01
R4752:Nomo1 UTSW 7 46057202 missense probably damaging 1.00
R4792:Nomo1 UTSW 7 46044219 splice site probably null
R4838:Nomo1 UTSW 7 46083715 missense unknown
R4876:Nomo1 UTSW 7 46066491 missense probably damaging 1.00
R4915:Nomo1 UTSW 7 46044232 missense probably benign 0.30
R4953:Nomo1 UTSW 7 46050731 intron probably benign
R5463:Nomo1 UTSW 7 46063002 missense possibly damaging 0.47
R5664:Nomo1 UTSW 7 46076157 missense probably benign
R5956:Nomo1 UTSW 7 46042613 missense possibly damaging 0.51
R6037:Nomo1 UTSW 7 46062999 missense possibly damaging 0.64
R6037:Nomo1 UTSW 7 46062999 missense possibly damaging 0.64
R6307:Nomo1 UTSW 7 46033836 unclassified probably benign
R6695:Nomo1 UTSW 7 46066461 missense probably benign 0.16
R6970:Nomo1 UTSW 7 46045967 missense probably damaging 0.97
R7334:Nomo1 UTSW 7 46083268 missense probably damaging 1.00
R7394:Nomo1 UTSW 7 46066479 missense probably benign 0.26
R7556:Nomo1 UTSW 7 46066218 missense probably damaging 1.00
R7834:Nomo1 UTSW 7 46056738 critical splice donor site probably null
R7917:Nomo1 UTSW 7 46056738 critical splice donor site probably null
Z1177:Nomo1 UTSW 7 46066273 missense not run
Predicted Primers PCR Primer
(F):5'- GTTCCCTGCAACCTCTAGTG -3'
(R):5'- CAGACCTACCAAGACAGGATGG -3'

Sequencing Primer
(F):5'- CTGCAACCTCTAGTGTAGCAG -3'
(R):5'- GGGACAGACCACCTTTCTC -3'
Posted On2015-07-07