Incidental Mutation 'R4406:Pdilt'
ID327660
Institutional Source Beutler Lab
Gene Symbol Pdilt
Ensembl Gene ENSMUSG00000030968
Gene Nameprotein disulfide isomerase-like, testis expressed
SynonymsPDILT, 1700007B13Rik
MMRRC Submission 041688-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R4406 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location119486587-119523489 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 119495009 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 340 (S340A)
Ref Sequence ENSEMBL: ENSMUSP00000033267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033267] [ENSMUST00000208275]
Predicted Effect probably damaging
Transcript: ENSMUST00000033267
AA Change: S340A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000033267
Gene: ENSMUSG00000030968
AA Change: S340A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 86 97 N/A INTRINSIC
Pfam:Thioredoxin_6 177 362 6e-35 PFAM
Pfam:Thioredoxin 385 489 3.7e-16 PFAM
low complexity region 495 512 N/A INTRINSIC
low complexity region 551 579 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194930
Predicted Effect probably benign
Transcript: ENSMUST00000208275
Meta Mutation Damage Score 0.1467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has has an N-terminal ER-signal sequence, two thioredoxin (TRX) domains with non-classical Ser-Lys-Gln-Ser and Ser-Lys-Lys-Cys motifs, respectively, two TRX-like domains, and a C-terminal ER-retention sequence. The protein lacks oxidoreductase activity in vitro and probably functions as a chaperone. This gene's expression appears to be limited to the testis. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility and abnormal sperm physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca C T 11: 84,280,449 L1170F probably benign Het
Acss3 A T 10: 107,053,337 D207E probably damaging Het
Adgrl1 T C 8: 83,930,042 S325P probably damaging Het
Ankrd37 A G 8: 45,997,094 probably benign Het
Atp13a2 C T 4: 141,006,476 P1059S probably damaging Het
Camkv T C 9: 107,946,219 probably null Het
Ces1f T C 8: 93,263,322 T387A probably benign Het
Dmxl1 T A 18: 49,889,553 L1653I probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fat2 G A 11: 55,262,268 A3706V probably benign Het
Fbln1 T A 15: 85,231,556 probably null Het
Gm1527 G A 3: 28,895,725 V45M possibly damaging Het
Gm5084 A G 13: 60,212,566 noncoding transcript Het
Itpr1 T A 6: 108,354,663 H194Q probably damaging Het
Kif24 A T 4: 41,393,954 L973Q probably damaging Het
Lrfn4 T C 19: 4,613,271 T412A probably benign Het
Ly75 T C 2: 60,354,550 E420G probably damaging Het
Map3k12 T C 15: 102,505,402 T45A probably damaging Het
Mib1 A C 18: 10,763,289 K446N probably damaging Het
Mrpl4 T C 9: 21,006,935 W146R probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Nomo1 A G 7: 46,056,668 N482S probably benign Het
Olfr1385 G A 11: 49,494,917 R128H probably benign Het
Olfr1411 T A 1: 92,597,314 M265K possibly damaging Het
Olfr1446 A T 19: 12,890,234 Y114* probably null Het
Olfr1458 A G 19: 13,102,594 S237P possibly damaging Het
Olfr935 T C 9: 38,994,569 I289V possibly damaging Het
Osbpl10 C T 9: 115,109,481 H70Y probably damaging Het
Ppan C A 9: 20,890,992 D226E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sema3g G A 14: 31,228,159 V766M probably benign Het
Skint6 T A 4: 113,156,486 N356I probably benign Het
Slco2b1 A T 7: 99,664,889 S496T probably benign Het
Trak1 T C 9: 121,431,536 V11A probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Umod G A 7: 119,466,064 P581S probably damaging Het
Zfat A G 15: 68,180,191 S585P probably benign Het
Zfp472 C A 17: 32,978,160 T403N probably benign Het
Zfp936 A G 7: 43,190,324 Q405R possibly damaging Het
Other mutations in Pdilt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Pdilt APN 7 119500444 missense probably damaging 1.00
IGL02102:Pdilt APN 7 119486950 missense probably benign 0.28
IGL02312:Pdilt APN 7 119519667 missense probably benign 0.03
IGL02887:Pdilt APN 7 119498049 missense possibly damaging 0.86
R0670:Pdilt UTSW 7 119500428 missense probably benign 0.03
R0759:Pdilt UTSW 7 119489484 nonsense probably null
R1525:Pdilt UTSW 7 119487994 missense probably damaging 0.99
R1612:Pdilt UTSW 7 119486975 missense possibly damaging 0.95
R1633:Pdilt UTSW 7 119487994 missense probably damaging 1.00
R1848:Pdilt UTSW 7 119489384 missense probably benign 0.02
R3026:Pdilt UTSW 7 119514954 missense probably benign 0.01
R3546:Pdilt UTSW 7 119500488 nonsense probably null
R5331:Pdilt UTSW 7 119514924 missense possibly damaging 0.67
R5459:Pdilt UTSW 7 119486935 missense probably benign 0.01
R5771:Pdilt UTSW 7 119494994 missense probably damaging 0.98
R5807:Pdilt UTSW 7 119500543 unclassified probably benign
R6143:Pdilt UTSW 7 119495042 missense probably damaging 1.00
R6456:Pdilt UTSW 7 119500483 missense probably damaging 0.99
R6850:Pdilt UTSW 7 119486959 missense probably damaging 0.98
R7159:Pdilt UTSW 7 119487951 missense probably benign 0.01
R7676:Pdilt UTSW 7 119494997 missense probably damaging 1.00
R8266:Pdilt UTSW 7 119489381 missense probably benign 0.01
R8282:Pdilt UTSW 7 119498070 missense probably damaging 1.00
R8437:Pdilt UTSW 7 119514886 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCGTGTCACGTTGAACCTC -3'
(R):5'- GGGTGCTCCTTAATCCTTGC -3'

Sequencing Primer
(F):5'- TCACGTTGAACCTCGGCAC -3'
(R):5'- ATTAGTTCCTAGCTTCTCAGTGG -3'
Posted On2015-07-07