Incidental Mutation 'R4406:Osbpl10'
ID327666
Institutional Source Beutler Lab
Gene Symbol Osbpl10
Ensembl Gene ENSMUSG00000040875
Gene Nameoxysterol binding protein-like 10
SynonymsC820004B04Rik, OPR-10, 4933433D06Rik
MMRRC Submission 041688-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4406 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location114978569-115232225 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 115109481 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 70 (H70Y)
Ref Sequence ENSEMBL: ENSMUSP00000138760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046627] [ENSMUST00000182199] [ENSMUST00000182384] [ENSMUST00000183104] [ENSMUST00000183141]
Predicted Effect probably benign
Transcript: ENSMUST00000046627
AA Change: H34Y

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000038013
Gene: ENSMUSG00000040875
AA Change: H34Y

DomainStartEndE-ValueType
low complexity region 95 116 N/A INTRINSIC
Pfam:Oxysterol_BP 229 535 7.8e-70 PFAM
Pfam:Oxysterol_BP 532 589 1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182199
SMART Domains Protein: ENSMUSP00000138206
Gene: ENSMUSG00000040875

DomainStartEndE-ValueType
Blast:PH 1 36 8e-19 BLAST
PDB:2D9X|A 1 42 2e-8 PDB
SCOP:d1ki1b2 10 42 7e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182363
Predicted Effect probably benign
Transcript: ENSMUST00000182384
AA Change: H70Y

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000138552
Gene: ENSMUSG00000040875
AA Change: H70Y

DomainStartEndE-ValueType
Blast:PH 1 36 8e-16 BLAST
PDB:2D9X|A 2 46 6e-7 PDB
SCOP:d1ki1b2 10 42 9e-3 SMART
low complexity region 131 152 N/A INTRINSIC
Pfam:Oxysterol_BP 262 626 1.5e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183104
AA Change: H209Y

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000138287
Gene: ENSMUSG00000040875
AA Change: H209Y

DomainStartEndE-ValueType
low complexity region 4 75 N/A INTRINSIC
PH 77 175 2.72e-15 SMART
low complexity region 270 291 N/A INTRINSIC
Pfam:Oxysterol_BP 401 765 1.4e-72 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183141
AA Change: H70Y

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138760
Gene: ENSMUSG00000040875
AA Change: H70Y

DomainStartEndE-ValueType
Blast:PH 1 36 3e-18 BLAST
PDB:2D9X|A 2 46 6e-8 PDB
SCOP:d1ki1b2 10 42 9e-4 SMART
low complexity region 131 152 N/A INTRINSIC
Meta Mutation Damage Score 0.0979 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Like most members, the encoded protein contains an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca C T 11: 84,280,449 L1170F probably benign Het
Acss3 A T 10: 107,053,337 D207E probably damaging Het
Adgrl1 T C 8: 83,930,042 S325P probably damaging Het
Ankrd37 A G 8: 45,997,094 probably benign Het
Atp13a2 C T 4: 141,006,476 P1059S probably damaging Het
Camkv T C 9: 107,946,219 probably null Het
Ces1f T C 8: 93,263,322 T387A probably benign Het
Dmxl1 T A 18: 49,889,553 L1653I probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fat2 G A 11: 55,262,268 A3706V probably benign Het
Fbln1 T A 15: 85,231,556 probably null Het
Gm1527 G A 3: 28,895,725 V45M possibly damaging Het
Gm5084 A G 13: 60,212,566 noncoding transcript Het
Itpr1 T A 6: 108,354,663 H194Q probably damaging Het
Kif24 A T 4: 41,393,954 L973Q probably damaging Het
Lrfn4 T C 19: 4,613,271 T412A probably benign Het
Ly75 T C 2: 60,354,550 E420G probably damaging Het
Map3k12 T C 15: 102,505,402 T45A probably damaging Het
Mib1 A C 18: 10,763,289 K446N probably damaging Het
Mrpl4 T C 9: 21,006,935 W146R probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Nomo1 A G 7: 46,056,668 N482S probably benign Het
Olfr1385 G A 11: 49,494,917 R128H probably benign Het
Olfr1411 T A 1: 92,597,314 M265K possibly damaging Het
Olfr1446 A T 19: 12,890,234 Y114* probably null Het
Olfr1458 A G 19: 13,102,594 S237P possibly damaging Het
Olfr935 T C 9: 38,994,569 I289V possibly damaging Het
Pdilt A C 7: 119,495,009 S340A probably damaging Het
Ppan C A 9: 20,890,992 D226E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sema3g G A 14: 31,228,159 V766M probably benign Het
Skint6 T A 4: 113,156,486 N356I probably benign Het
Slco2b1 A T 7: 99,664,889 S496T probably benign Het
Trak1 T C 9: 121,431,536 V11A probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Umod G A 7: 119,466,064 P581S probably damaging Het
Zfat A G 15: 68,180,191 S585P probably benign Het
Zfp472 C A 17: 32,978,160 T403N probably benign Het
Zfp936 A G 7: 43,190,324 Q405R possibly damaging Het
Other mutations in Osbpl10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Osbpl10 APN 9 115176002 missense probably benign 0.01
IGL01318:Osbpl10 APN 9 115232122 nonsense probably null
IGL02023:Osbpl10 APN 9 115226722 missense probably damaging 1.00
IGL02096:Osbpl10 APN 9 115216994 missense possibly damaging 0.94
R0534:Osbpl10 UTSW 9 115167178 missense probably damaging 1.00
R0948:Osbpl10 UTSW 9 115167119 missense probably damaging 1.00
R1073:Osbpl10 UTSW 9 115207553 nonsense probably null
R2138:Osbpl10 UTSW 9 115232134 missense probably benign 0.06
R3709:Osbpl10 UTSW 9 115207587 missense probably benign 0.11
R3710:Osbpl10 UTSW 9 115207587 missense probably benign 0.11
R4738:Osbpl10 UTSW 9 115216574 missense probably damaging 1.00
R4778:Osbpl10 UTSW 9 115109530 missense probably damaging 1.00
R4779:Osbpl10 UTSW 9 115109530 missense probably damaging 1.00
R5828:Osbpl10 UTSW 9 115061876 missense probably damaging 0.97
R5874:Osbpl10 UTSW 9 115226760 missense probably damaging 1.00
R6052:Osbpl10 UTSW 9 115067315 unclassified probably null
R6103:Osbpl10 UTSW 9 115061872 nonsense probably null
R6174:Osbpl10 UTSW 9 115109487 missense probably benign 0.00
R6246:Osbpl10 UTSW 9 115226774 missense probably benign 0.34
R7008:Osbpl10 UTSW 9 115061848 missense probably damaging 1.00
R7027:Osbpl10 UTSW 9 115223698 missense probably damaging 0.97
R7182:Osbpl10 UTSW 9 115067251 missense probably damaging 1.00
R7285:Osbpl10 UTSW 9 115223703 missense probably damaging 1.00
R7556:Osbpl10 UTSW 9 115207624 missense probably damaging 1.00
R7810:Osbpl10 UTSW 9 115061894 missense probably benign 0.01
R7853:Osbpl10 UTSW 9 115207658 missense probably damaging 1.00
R7905:Osbpl10 UTSW 9 115062010 critical splice donor site probably null
R7936:Osbpl10 UTSW 9 115207658 missense probably damaging 1.00
R7988:Osbpl10 UTSW 9 115062010 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTACGTCCTTTAAAACAGATCAGGG -3'
(R):5'- CTGGAAGAACAGCTGCAAGC -3'

Sequencing Primer
(F):5'- GGGGAATCCACGCCCATAC -3'
(R):5'- AGGCTGGGAGAGTACATCTATTC -3'
Posted On2015-07-07