Incidental Mutation 'R4406:Sema3g'
ID327674
Institutional Source Beutler Lab
Gene Symbol Sema3g
Ensembl Gene ENSMUSG00000021904
Gene Namesema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G
Synonyms
MMRRC Submission 041688-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4406 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location31217860-31230352 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 31228159 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 766 (V766M)
Ref Sequence ENSEMBL: ENSMUSP00000087643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090180]
Predicted Effect probably benign
Transcript: ENSMUST00000090180
AA Change: V766M

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000087643
Gene: ENSMUSG00000021904
AA Change: V766M

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Sema 58 503 2.96e-184 SMART
PSI 521 574 3.2e-11 SMART
IG 588 674 6.41e-2 SMART
Meta Mutation Damage Score 0.1975 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transcription of this gene is activated by PPAR-gamma, and the resulting protein product plays a role in endothelial cell migration. Expression of this gene also inhibits tumor cell migration and invasion. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased lymphatic branching complexity with decreased lymphatic width. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca C T 11: 84,280,449 L1170F probably benign Het
Acss3 A T 10: 107,053,337 D207E probably damaging Het
Adgrl1 T C 8: 83,930,042 S325P probably damaging Het
Ankrd37 A G 8: 45,997,094 probably benign Het
Atp13a2 C T 4: 141,006,476 P1059S probably damaging Het
Camkv T C 9: 107,946,219 probably null Het
Ces1f T C 8: 93,263,322 T387A probably benign Het
Dmxl1 T A 18: 49,889,553 L1653I probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fat2 G A 11: 55,262,268 A3706V probably benign Het
Fbln1 T A 15: 85,231,556 probably null Het
Gm1527 G A 3: 28,895,725 V45M possibly damaging Het
Gm5084 A G 13: 60,212,566 noncoding transcript Het
Itpr1 T A 6: 108,354,663 H194Q probably damaging Het
Kif24 A T 4: 41,393,954 L973Q probably damaging Het
Lrfn4 T C 19: 4,613,271 T412A probably benign Het
Ly75 T C 2: 60,354,550 E420G probably damaging Het
Map3k12 T C 15: 102,505,402 T45A probably damaging Het
Mib1 A C 18: 10,763,289 K446N probably damaging Het
Mrpl4 T C 9: 21,006,935 W146R probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Nomo1 A G 7: 46,056,668 N482S probably benign Het
Olfr1385 G A 11: 49,494,917 R128H probably benign Het
Olfr1411 T A 1: 92,597,314 M265K possibly damaging Het
Olfr1446 A T 19: 12,890,234 Y114* probably null Het
Olfr1458 A G 19: 13,102,594 S237P possibly damaging Het
Olfr935 T C 9: 38,994,569 I289V possibly damaging Het
Osbpl10 C T 9: 115,109,481 H70Y probably damaging Het
Pdilt A C 7: 119,495,009 S340A probably damaging Het
Ppan C A 9: 20,890,992 D226E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Skint6 T A 4: 113,156,486 N356I probably benign Het
Slco2b1 A T 7: 99,664,889 S496T probably benign Het
Trak1 T C 9: 121,431,536 V11A probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Umod G A 7: 119,466,064 P581S probably damaging Het
Zfat A G 15: 68,180,191 S585P probably benign Het
Zfp472 C A 17: 32,978,160 T403N probably benign Het
Zfp936 A G 7: 43,190,324 Q405R possibly damaging Het
Other mutations in Sema3g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Sema3g APN 14 31221727 missense probably damaging 1.00
IGL01650:Sema3g APN 14 31221787 missense probably benign 0.00
IGL01782:Sema3g APN 14 31227791 missense probably damaging 1.00
IGL01784:Sema3g APN 14 31222967 missense probably damaging 1.00
IGL01869:Sema3g APN 14 31223667 missense probably damaging 1.00
IGL01999:Sema3g APN 14 31217965 missense probably benign
IGL02095:Sema3g APN 14 31227824 missense probably benign 0.00
IGL02232:Sema3g APN 14 31221224 missense probably damaging 1.00
IGL02477:Sema3g APN 14 31227866 missense probably damaging 0.98
IGL02583:Sema3g APN 14 31221519 critical splice acceptor site probably null
R0791:Sema3g UTSW 14 31220904 splice site probably benign
R1225:Sema3g UTSW 14 31220679 missense probably damaging 1.00
R1471:Sema3g UTSW 14 31228045 missense probably damaging 1.00
R2303:Sema3g UTSW 14 31222615 missense probably damaging 1.00
R3968:Sema3g UTSW 14 31226521 critical splice donor site probably null
R3970:Sema3g UTSW 14 31226521 critical splice donor site probably null
R4773:Sema3g UTSW 14 31220709 missense probably benign 0.04
R7968:Sema3g UTSW 14 31220648 missense probably damaging 0.99
R8179:Sema3g UTSW 14 31220585 missense probably benign 0.00
RF021:Sema3g UTSW 14 31227841 missense probably damaging 1.00
X0013:Sema3g UTSW 14 31222111 missense probably benign 0.02
Z1177:Sema3g UTSW 14 31226397 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TTCCTTCGGGAGTCAAGGCTAG -3'
(R):5'- AACCCCTAGTCTTTCCTGTAGG -3'

Sequencing Primer
(F):5'- TGCCTCCCCCAAGACTTG -3'
(R):5'- AGGTGGTGGAGATTTCCTCTAAGAG -3'
Posted On2015-07-07