Incidental Mutation 'R4407:Dolpp1'
ID327687
Institutional Source Beutler Lab
Gene Symbol Dolpp1
Ensembl Gene ENSMUSG00000026856
Gene Namedolichyl pyrophosphate phosphatase 1
Synonyms0610011H20Rik, LSFR2
MMRRC Submission 041689-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock #R4407 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location30392254-30400529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30396452 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 128 (A128V)
Ref Sequence ENSEMBL: ENSMUSP00000109242 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028207] [ENSMUST00000028209] [ENSMUST00000102855] [ENSMUST00000113612] [ENSMUST00000123202]
Predicted Effect probably benign
Transcript: ENSMUST00000028207
SMART Domains Protein: ENSMUSP00000028207
Gene: ENSMUSG00000026853

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 34 616 1.9e-235 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000028209
AA Change: A128V

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028209
Gene: ENSMUSG00000026856
AA Change: A128V

DomainStartEndE-ValueType
acidPPc 59 180 1.31e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102855
SMART Domains Protein: ENSMUSP00000099919
Gene: ENSMUSG00000026853

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 35 615 2.4e-195 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113612
AA Change: A128V

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109242
Gene: ENSMUSG00000026856
AA Change: A128V

DomainStartEndE-ValueType
Pfam:PAP2 58 165 1.7e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000123202
AA Change: A30V

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119478
Gene: ENSMUSG00000026856
AA Change: A30V

DomainStartEndE-ValueType
Pfam:PAP2 1 90 8.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133991
Predicted Effect probably benign
Transcript: ENSMUST00000137248
SMART Domains Protein: ENSMUSP00000116276
Gene: ENSMUSG00000026856

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
low complexity region 71 90 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152303
Predicted Effect probably benign
Transcript: ENSMUST00000155196
SMART Domains Protein: ENSMUSP00000115602
Gene: ENSMUSG00000026856

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
low complexity region 69 88 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156984
Meta Mutation Damage Score 0.1583 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A similar gene has been characterized in mice and encodes dolichyl pyrophosphate (Dol-P-P) phosphatase. This protein dephosphorylates dolichyl pyrophosphate so that it may be re-utilized as a glycosyl carrier lipid by the oligosaccharyltransferase multisubunit complex in the ER. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830035A12Rik T C 11: 107,532,055 noncoding transcript Het
Bbs10 A G 10: 111,299,859 T278A probably benign Het
BC053393 A G 11: 46,577,380 T94A probably damaging Het
Bcl6b A G 11: 70,226,103 L450P probably damaging Het
Braf T G 6: 39,615,720 K674Q probably damaging Het
Cep112 C T 11: 108,519,201 T481I possibly damaging Het
Cep135 T A 5: 76,624,667 M633K probably benign Het
Cpped1 T C 16: 11,805,421 Y278C probably damaging Het
Depdc5 T A 5: 32,904,534 probably null Het
E2f5 T A 3: 14,603,763 D238E probably benign Het
Fat4 A T 3: 38,958,540 D2328V probably benign Het
Fbln1 T A 15: 85,231,556 probably null Het
Fkbp3 T C 12: 65,070,004 T53A probably damaging Het
Flg2 G T 3: 93,214,869 G1449C unknown Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Glyctk A T 9: 106,157,108 probably benign Het
Gm37596 C A 3: 93,692,112 V317L probably benign Het
Gm6430 T C 1: 97,025,572 noncoding transcript Het
Golga1 C A 2: 39,019,641 probably null Het
Gucy2g A T 19: 55,237,837 F216I probably benign Het
L3mbtl3 A G 10: 26,313,884 V494A unknown Het
Lama2 AATCAGACAGGAG A 10: 27,212,128 probably benign Het
Lemd3 A T 10: 120,925,430 L907Q possibly damaging Het
Lrp2 A T 2: 69,502,517 V1552D probably damaging Het
Map3k12 T C 15: 102,505,402 T45A probably damaging Het
Mycbp2 A T 14: 103,287,228 D665E probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Olfr1178 A T 2: 88,392,083 M279L probably benign Het
Pcdhac2 G T 18: 37,144,446 V160L probably benign Het
Pcnt T C 10: 76,374,870 E2473G possibly damaging Het
Pitpnm2 T A 5: 124,152,615 I3L possibly damaging Het
Prkd3 C A 17: 78,983,558 W176L probably damaging Het
Prpf39 C T 12: 65,056,266 A438V probably damaging Het
Rpgrip1 T A 14: 52,147,399 F655I probably damaging Het
Rrp12 T C 19: 41,892,551 Y147C probably damaging Het
Sec23b A T 2: 144,574,718 N429Y possibly damaging Het
Slc2a10 T A 2: 165,514,764 S115T probably damaging Het
Spg11 A C 2: 122,075,332 D1277E probably benign Het
Sspo A G 6: 48,460,520 D1279G probably damaging Het
St18 T C 1: 6,827,837 I621T probably benign Het
Tbc1d31 T A 15: 57,920,042 D112E possibly damaging Het
Tgm4 A T 9: 123,056,530 D379V probably damaging Het
Thyn1 A T 9: 27,003,597 D15V possibly damaging Het
Tm4sf19 T C 16: 32,407,894 V167A possibly damaging Het
Trim38 A C 13: 23,791,491 Q471P probably benign Het
Trmt1 T A 8: 84,697,755 probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Usp9y T C Y: 1,336,375 I1500V probably benign Het
Vgll4 C T 6: 114,890,612 probably null Het
Vmn1r173 T A 7: 23,703,016 N225K probably damaging Het
Vmn2r22 C T 6: 123,637,954 G226R probably damaging Het
Wnk3 C A X: 151,233,213 P555Q probably benign Het
Yes1 T G 5: 32,640,585 Y83D possibly damaging Het
Zdhhc15 G A X: 104,560,688 R322* probably null Het
Other mutations in Dolpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Dolpp1 APN 2 30397095 missense probably damaging 1.00
IGL02896:Dolpp1 APN 2 30396230 missense probably damaging 0.99
R1321:Dolpp1 UTSW 2 30395736 missense possibly damaging 0.83
R2032:Dolpp1 UTSW 2 30392441 missense probably damaging 1.00
R3722:Dolpp1 UTSW 2 30397488 missense probably damaging 0.98
R5417:Dolpp1 UTSW 2 30396237 missense probably damaging 1.00
R5895:Dolpp1 UTSW 2 30395646 splice site probably benign
R6270:Dolpp1 UTSW 2 30392269 unclassified probably benign
R7818:Dolpp1 UTSW 2 30396491 missense probably benign 0.24
R8108:Dolpp1 UTSW 2 30396246 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TGTATTTAAGGTGAGAGCCTACCC -3'
(R):5'- TCATAACCTACAGTGTCTGGGC -3'

Sequencing Primer
(F):5'- TAAGGTGAGAGCCTACCCGTACC -3'
(R):5'- TACAGTGTCTGGGCCCAGG -3'
Posted On2015-07-07