Mutagenetix > Incidental Mutation

Incidental Mutation 'R4407:Golga1'

327688

Institutional Source

Beutler Lab

Gene Symbol

Golga1

Ensembl Gene

ENSMUSG00000026754

Gene Name

golgi autoantigen, golgin subfamily a, 1

Synonyms

0710001G09Rik, Golgi97, golgin-97, 2210418B03Rik

MMRRC Submission

041689-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.235) question?

Stock #

R4407 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

39016155-39065541 bp(-) (GRCm38)

Type of Mutation

splice site (3764 bp from exon)

DNA Base Change (assembly)

C to A at 39019641 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000108483 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039165] [ENSMUST00000090993] [ENSMUST00000112850] [ENSMUST00000112862] [ENSMUST00000184996]

AlphaFold

Q9CW79

Predicted Effect

probably damaging
Transcript: ENSMUST00000039165
AA Change: D651Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000037735
Gene: ENSMUSG00000026754
AA Change: D651Y

Domain	Start	End	E-Value	Type
coiled coil region	51	104	N/A	INTRINSIC
coiled coil region	126	169	N/A	INTRINSIC
coiled coil region	190	555	N/A	INTRINSIC
coiled coil region	599	647	N/A	INTRINSIC
Grip	682	728	5.68e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000090993

SMART Domains

Protein: ENSMUSP00000088516
Gene: ENSMUSG00000026755

Domain	Start	End	E-Value	Type
Pfam:P16-Arc	8	153	4.6e-52	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000112850
AA Change: D626Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108471
Gene: ENSMUSG00000026754
AA Change: D626Y

Domain	Start	End	E-Value	Type
coiled coil region	53	144	N/A	INTRINSIC
coiled coil region	165	530	N/A	INTRINSIC
coiled coil region	574	622	N/A	INTRINSIC
Grip	657	703	5.68e-18	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000112862

SMART Domains

Protein: ENSMUSP00000108483
Gene: ENSMUSG00000026755

Domain	Start	End	E-Value	Type
Pfam:P16-Arc	9	153	2.4e-58	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124463

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126520

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135049

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141467

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149842

Predicted Effect

probably benign
Transcript: ENSMUST00000153914

Predicted Effect

probably damaging
Transcript: ENSMUST00000184996
AA Change: D651Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000139001
Gene: ENSMUSG00000026754
AA Change: D651Y

Domain	Start	End	E-Value	Type
coiled coil region	51	104	N/A	INTRINSIC
coiled coil region	126	169	N/A	INTRINSIC
coiled coil region	190	555	N/A	INTRINSIC
coiled coil region	599	647	N/A	INTRINSIC
Grip	682	728	5.68e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000154210

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204127

Meta Mutation Damage Score

0.3410

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This encoded protein is associated with Sjogren's syndrome. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous mice exhibit tremors and limb grasping behavior at two months of age. A variable severity of hearing loss was also seen. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830035A12Rik	T	C	11: 107,532,055		noncoding transcript	Het
Bbs10	A	G	10: 111,299,859	T278A	probably benign	Het
BC053393	A	G	11: 46,577,380	T94A	probably damaging	Het
Bcl6b	A	G	11: 70,226,103	L450P	probably damaging	Het
Braf	T	G	6: 39,615,720	K674Q	probably damaging	Het
Cep112	C	T	11: 108,519,201	T481I	possibly damaging	Het
Cep135	T	A	5: 76,624,667	M633K	probably benign	Het
Cpped1	T	C	16: 11,805,421	Y278C	probably damaging	Het
Depdc5	T	A	5: 32,904,534		probably null	Het
Dolpp1	C	T	2: 30,396,452	A128V	possibly damaging	Het
E2f5	T	A	3: 14,603,763	D238E	probably benign	Het
Fat4	A	T	3: 38,958,540	D2328V	probably benign	Het
Fbln1	T	A	15: 85,231,556		probably null	Het
Fkbp3	T	C	12: 65,070,004	T53A	probably damaging	Het
Flg2	G	T	3: 93,214,869	G1449C	unknown	Het
G530012D18Rik	G	C	1: 85,577,202		probably benign	Het
Glyctk	A	T	9: 106,157,108		probably benign	Het
Gm37596	C	A	3: 93,692,112	V317L	probably benign	Het
Gm6430	T	C	1: 97,025,572		noncoding transcript	Het
Gucy2g	A	T	19: 55,237,837	F216I	probably benign	Het
L3mbtl3	A	G	10: 26,313,884	V494A	unknown	Het
Lama2	AATCAGACAGGAG	A	10: 27,212,128		probably benign	Het
Lemd3	A	T	10: 120,925,430	L907Q	possibly damaging	Het
Lrp2	A	T	2: 69,502,517	V1552D	probably damaging	Het
Map3k12	T	C	15: 102,505,402	T45A	probably damaging	Het
Mycbp2	A	T	14: 103,287,228	D665E	probably damaging	Het
Myof	A	G	19: 37,922,978	S1502P	probably damaging	Het
Olfr1178	A	T	2: 88,392,083	M279L	probably benign	Het
Pcdhac2	G	T	18: 37,144,446	V160L	probably benign	Het
Pcnt	T	C	10: 76,374,870	E2473G	possibly damaging	Het
Pitpnm2	T	A	5: 124,152,615	I3L	possibly damaging	Het
Prkd3	C	A	17: 78,983,558	W176L	probably damaging	Het
Prpf39	C	T	12: 65,056,266	A438V	probably damaging	Het
Rpgrip1	T	A	14: 52,147,399	F655I	probably damaging	Het
Rrp12	T	C	19: 41,892,551	Y147C	probably damaging	Het
Sec23b	A	T	2: 144,574,718	N429Y	possibly damaging	Het
Slc2a10	T	A	2: 165,514,764	S115T	probably damaging	Het
Spg11	A	C	2: 122,075,332	D1277E	probably benign	Het
Sspo	A	G	6: 48,460,520	D1279G	probably damaging	Het
St18	T	C	1: 6,827,837	I621T	probably benign	Het
Tbc1d31	T	A	15: 57,920,042	D112E	possibly damaging	Het
Tgm4	A	T	9: 123,056,530	D379V	probably damaging	Het
Thyn1	A	T	9: 27,003,597	D15V	possibly damaging	Het
Tm4sf19	T	C	16: 32,407,894	V167A	possibly damaging	Het
Trim38	A	C	13: 23,791,491	Q471P	probably benign	Het
Trmt1	T	A	8: 84,697,755		probably benign	Het
Ubqlnl	C	T	7: 104,149,718	V191M	probably benign	Het
Usp9y	T	C	Y: 1,336,375	I1500V	probably benign	Het
Vgll4	C	T	6: 114,890,612		probably null	Het
Vmn1r173	T	A	7: 23,703,016	N225K	probably damaging	Het
Vmn2r22	C	T	6: 123,637,954	G226R	probably damaging	Het
Wnk3	C	A	X: 151,233,213	P555Q	probably benign	Het
Yes1	T	G	5: 32,640,585	Y83D	possibly damaging	Het
Zdhhc15	G	A	X: 104,560,688	R322*	probably null	Het

Other mutations in Golga1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00806:Golga1	APN	2	39052973	nonsense	probably null
IGL00949:Golga1	APN	2	39041255	missense	probably damaging	0.98
IGL01133:Golga1	APN	2	39023472	missense	probably benign
IGL01592:Golga1	APN	2	39063282	missense	probably damaging	1.00
IGL01613:Golga1	APN	2	39020126	missense	probably benign	0.14
IGL01819:Golga1	APN	2	39034149	missense	probably benign	0.00
IGL01871:Golga1	APN	2	39050198	splice site	probably benign
IGL02744:Golga1	APN	2	39018474	missense	probably damaging	1.00
IGL02819:Golga1	APN	2	39039078	missense	probably null	0.97
IGL02874:Golga1	APN	2	39039092	missense	probably damaging	1.00
R0167:Golga1	UTSW	2	39047648	missense	probably benign	0.00
R0245:Golga1	UTSW	2	39035259	missense	probably benign	0.00
R0389:Golga1	UTSW	2	39018441	missense	probably damaging	1.00
R0443:Golga1	UTSW	2	39018441	missense	probably damaging	1.00
R0906:Golga1	UTSW	2	39047643	missense	probably damaging	0.99
R1508:Golga1	UTSW	2	39023249	missense	probably benign
R1901:Golga1	UTSW	2	39047780	splice site	probably null
R1964:Golga1	UTSW	2	39047087	missense	probably benign	0.00
R2228:Golga1	UTSW	2	39023171	missense	probably benign	0.02
R3734:Golga1	UTSW	2	39050170	missense	possibly damaging	0.88
R4504:Golga1	UTSW	2	39023454	missense	probably benign	0.00
R4973:Golga1	UTSW	2	39039106	missense	probably damaging	0.99
R5049:Golga1	UTSW	2	39047735	missense	probably damaging	1.00
R5600:Golga1	UTSW	2	39020099	missense	probably damaging	1.00
R6008:Golga1	UTSW	2	39047087	missense	probably benign	0.00
R6374:Golga1	UTSW	2	39034068	missense	probably benign
R6388:Golga1	UTSW	2	39023171	missense	probably benign	0.02
R6601:Golga1	UTSW	2	39020106	missense	probably damaging	1.00
R7067:Golga1	UTSW	2	39047719	missense	probably benign	0.00
R7816:Golga1	UTSW	2	39052098	missense	probably damaging	1.00
R9277:Golga1	UTSW	2	39024243	missense	probably benign	0.19
R9581:Golga1	UTSW	2	39019561	missense	probably damaging	1.00
X0025:Golga1	UTSW	2	39052062	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGCCTTTACCTCAGATTCTCG -3'
(R):5'- TGACCTTGGGCAGAAGTCTG -3'

Sequencing Primer
(F):5'- TCAGATTCTCGACAGGACATG -3'
(R):5'- CCTGCCTGTGTTCTCAAATAGATAG -3'

Posted On

2015-07-07