Incidental Mutation 'R4407:E2f5'
ID 327695
Institutional Source Beutler Lab
Gene Symbol E2f5
Ensembl Gene ENSMUSG00000027552
Gene Name E2F transcription factor 5
Synonyms E2F-5
MMRRC Submission 041689-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.677) question?
Stock # R4407 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 14643701-14671369 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 14668823 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 238 (D238E)
Ref Sequence ENSEMBL: ENSMUSP00000127877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029069] [ENSMUST00000108365] [ENSMUST00000165922] [ENSMUST00000185384] [ENSMUST00000185423] [ENSMUST00000186870]
AlphaFold Q61502
Predicted Effect probably benign
Transcript: ENSMUST00000029069
AA Change: D237E

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000029069
Gene: ENSMUSG00000027552
AA Change: D237E

DomainStartEndE-ValueType
low complexity region 6 33 N/A INTRINSIC
Pfam:E2F_TDP 40 106 3.3e-28 PFAM
coiled coil region 111 146 N/A INTRINSIC
low complexity region 223 256 N/A INTRINSIC
low complexity region 283 293 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108365
SMART Domains Protein: ENSMUSP00000104002
Gene: ENSMUSG00000078784

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165922
AA Change: D238E

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000127877
Gene: ENSMUSG00000027552
AA Change: D238E

DomainStartEndE-ValueType
low complexity region 6 33 N/A INTRINSIC
E2F_TDP 40 106 8.76e-31 SMART
Pfam:E2F_CC-MB 123 221 6.9e-35 PFAM
low complexity region 224 257 N/A INTRINSIC
low complexity region 284 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185384
Predicted Effect probably benign
Transcript: ENSMUST00000185423
Predicted Effect probably benign
Transcript: ENSMUST00000186870
Meta Mutation Damage Score 0.0711 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionarily conserved domains that are present in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein is differentially phosphorylated and is expressed in a wide variety of human tissues. It has higher identity to E2F4 than to other family members. Both this protein and E2F4 interact with tumor suppressor proteins p130 and p107, but not with pRB. Alternative splicing results in multiple variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice develop non-obstructive hydrocephalus, ruffled coats, ataxic gait, and dehydration after weaning and die prematurely at an average age of 6 weeks. They exhibit dilated ventricles and cerebral cortex atrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830035A12Rik T C 11: 107,422,881 (GRCm39) noncoding transcript Het
Bbs10 A G 10: 111,135,720 (GRCm39) T278A probably benign Het
Bcl6b A G 11: 70,116,929 (GRCm39) L450P probably damaging Het
Braf T G 6: 39,592,654 (GRCm39) K674Q probably damaging Het
Cep112 C T 11: 108,410,027 (GRCm39) T481I possibly damaging Het
Cep135 T A 5: 76,772,514 (GRCm39) M633K probably benign Het
Cpped1 T C 16: 11,623,285 (GRCm39) Y278C probably damaging Het
Depdc5 T A 5: 33,061,878 (GRCm39) probably null Het
Dolpp1 C T 2: 30,286,464 (GRCm39) A128V possibly damaging Het
Fat4 A T 3: 39,012,689 (GRCm39) D2328V probably benign Het
Fbln1 T A 15: 85,115,757 (GRCm39) probably null Het
Fkbp3 T C 12: 65,116,778 (GRCm39) T53A probably damaging Het
Flg2 G T 3: 93,122,176 (GRCm39) G1449C unknown Het
G530012D18Rik G C 1: 85,504,923 (GRCm39) probably benign Het
Glyctk A T 9: 106,034,307 (GRCm39) probably benign Het
Gm6430 T C 1: 96,953,297 (GRCm39) noncoding transcript Het
Golga1 C A 2: 38,909,653 (GRCm39) probably null Het
Gucy2g A T 19: 55,226,269 (GRCm39) F216I probably benign Het
L3mbtl3 A G 10: 26,189,782 (GRCm39) V494A unknown Het
Lama2 AATCAGACAGGAG A 10: 27,088,124 (GRCm39) probably benign Het
Lemd3 A T 10: 120,761,335 (GRCm39) L907Q possibly damaging Het
Lrp2 A T 2: 69,332,861 (GRCm39) V1552D probably damaging Het
Map3k12 T C 15: 102,413,837 (GRCm39) T45A probably damaging Het
Mycbp2 A T 14: 103,524,664 (GRCm39) D665E probably damaging Het
Myof A G 19: 37,911,426 (GRCm39) S1502P probably damaging Het
Or4p7 A T 2: 88,222,427 (GRCm39) M279L probably benign Het
Pcdhac2 G T 18: 37,277,499 (GRCm39) V160L probably benign Het
Pcnt T C 10: 76,210,704 (GRCm39) E2473G possibly damaging Het
Pitpnm2 T A 5: 124,290,678 (GRCm39) I3L possibly damaging Het
Prkd3 C A 17: 79,290,987 (GRCm39) W176L probably damaging Het
Prpf39 C T 12: 65,103,040 (GRCm39) A438V probably damaging Het
Rpgrip1 T A 14: 52,384,856 (GRCm39) F655I probably damaging Het
Rrp12 T C 19: 41,880,990 (GRCm39) Y147C probably damaging Het
Sec23b A T 2: 144,416,638 (GRCm39) N429Y possibly damaging Het
Slc2a10 T A 2: 165,356,684 (GRCm39) S115T probably damaging Het
Spg11 A C 2: 121,905,813 (GRCm39) D1277E probably benign Het
Sspo A G 6: 48,437,454 (GRCm39) D1279G probably damaging Het
St18 T C 1: 6,898,061 (GRCm39) I621T probably benign Het
Tbc1d31 T A 15: 57,783,438 (GRCm39) D112E possibly damaging Het
Tdpoz6 C A 3: 93,599,419 (GRCm39) V317L probably benign Het
Tgm4 A T 9: 122,885,595 (GRCm39) D379V probably damaging Het
Thyn1 A T 9: 26,914,893 (GRCm39) D15V possibly damaging Het
Timd6 A G 11: 46,468,207 (GRCm39) T94A probably damaging Het
Tm4sf19 T C 16: 32,226,712 (GRCm39) V167A possibly damaging Het
Trim38 A C 13: 23,975,474 (GRCm39) Q471P probably benign Het
Trmt1 T A 8: 85,424,384 (GRCm39) probably benign Het
Ubqlnl C T 7: 103,798,925 (GRCm39) V191M probably benign Het
Usp9y T C Y: 1,336,375 (GRCm39) I1500V probably benign Het
Vgll4 C T 6: 114,867,573 (GRCm39) probably null Het
Vmn1r173 T A 7: 23,402,441 (GRCm39) N225K probably damaging Het
Vmn2r22 C T 6: 123,614,913 (GRCm39) G226R probably damaging Het
Wnk3 C A X: 150,016,209 (GRCm39) P555Q probably benign Het
Yes1 T G 5: 32,797,929 (GRCm39) Y83D possibly damaging Het
Zdhhc15 G A X: 103,604,294 (GRCm39) R322* probably null Het
Other mutations in E2f5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01987:E2f5 APN 3 14,652,363 (GRCm39) splice site probably benign
IGL02388:E2f5 APN 3 14,653,340 (GRCm39) missense probably benign 0.00
IGL02415:E2f5 APN 3 14,668,957 (GRCm39) missense probably benign 0.00
R0401:E2f5 UTSW 3 14,644,085 (GRCm39) critical splice donor site probably null
R1977:E2f5 UTSW 3 14,652,416 (GRCm39) missense probably damaging 1.00
R2434:E2f5 UTSW 3 14,644,074 (GRCm39) missense probably damaging 1.00
R3029:E2f5 UTSW 3 14,668,725 (GRCm39) missense probably benign 0.37
R4405:E2f5 UTSW 3 14,668,823 (GRCm39) missense probably benign 0.09
R4780:E2f5 UTSW 3 14,652,379 (GRCm39) missense probably benign 0.01
R6627:E2f5 UTSW 3 14,668,917 (GRCm39) missense probably benign 0.06
R9557:E2f5 UTSW 3 14,653,311 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TTCCGTGAATTTAGGTGTTAGATCC -3'
(R):5'- TTCAGGATAGATCTCTGGGCTG -3'

Sequencing Primer
(F):5'- AGGTGTTAGATCCTAATGACTTTCC -3'
(R):5'- ATAGATCTCTGGGCTGTTTCATAGAG -3'
Posted On 2015-07-07