Mutagenetix > Incidental Mutations

Incidental Mutation 'R4407:Cep135'

327704

Institutional Source

Beutler Lab

Gene Symbol

Cep135

Ensembl Gene

ENSMUSG00000036403

Gene Name

centrosomal protein 135

Synonyms

LOC381644, Cep4

MMRRC Submission

041689-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4407 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

76588698-76646466 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 76624667 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 633 (M633K)

Ref Sequence

ENSEMBL: ENSMUSP00000112602 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049060] [ENSMUST00000121979]

Predicted Effect

probably benign
Transcript: ENSMUST00000049060
AA Change: M633K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000038674
Gene: ENSMUSG00000036403
AA Change: M633K

Domain	Start	End	E-Value	Type
internal_repeat_1	47	71	1.87e-5	PROSPERO
low complexity region	78	92	N/A	INTRINSIC
internal_repeat_1	100	124	1.87e-5	PROSPERO
coiled coil region	125	153	N/A	INTRINSIC
coiled coil region	194	245	N/A	INTRINSIC
coiled coil region	267	420	N/A	INTRINSIC
coiled coil region	445	470	N/A	INTRINSIC
Blast:HAMP	492	527	5e-11	BLAST
Blast:SPEC	760	863	6e-21	BLAST
low complexity region	1060	1072	N/A	INTRINSIC
coiled coil region	1075	1117	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000121979
AA Change: M633K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000112602
Gene: ENSMUSG00000036403
AA Change: M633K

Domain	Start	End	E-Value	Type
internal_repeat_1	47	71	1.87e-5	PROSPERO
low complexity region	78	92	N/A	INTRINSIC
internal_repeat_1	100	124	1.87e-5	PROSPERO
coiled coil region	125	153	N/A	INTRINSIC
coiled coil region	194	245	N/A	INTRINSIC
coiled coil region	267	420	N/A	INTRINSIC
coiled coil region	445	470	N/A	INTRINSIC
Blast:HAMP	492	527	5e-11	BLAST
Blast:SPEC	760	863	6e-21	BLAST
low complexity region	1060	1072	N/A	INTRINSIC
coiled coil region	1075	1117	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130651

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein, which acts as a scaffolding protein during early centriole biogenesis, and is also required for centriole-centriole cohesion during interphase. Mutations in this gene are associated with autosomal recessive primary microcephaly-8. [provided by RefSeq, Jun 2012]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830035A12Rik	T	C	11: 107,532,055		noncoding transcript	Het
Bbs10	A	G	10: 111,299,859	T278A	probably benign	Het
BC053393	A	G	11: 46,577,380	T94A	probably damaging	Het
Bcl6b	A	G	11: 70,226,103	L450P	probably damaging	Het
Braf	T	G	6: 39,615,720	K674Q	probably damaging	Het
Cep112	C	T	11: 108,519,201	T481I	possibly damaging	Het
Cpped1	T	C	16: 11,805,421	Y278C	probably damaging	Het
Depdc5	T	A	5: 32,904,534		probably null	Het
Dolpp1	C	T	2: 30,396,452	A128V	possibly damaging	Het
E2f5	T	A	3: 14,603,763	D238E	probably benign	Het
Fat4	A	T	3: 38,958,540	D2328V	probably benign	Het
Fbln1	T	A	15: 85,231,556		probably null	Het
Fkbp3	T	C	12: 65,070,004	T53A	probably damaging	Het
Flg2	G	T	3: 93,214,869	G1449C	unknown	Het
G530012D18Rik	G	C	1: 85,577,202		probably benign	Het
Glyctk	A	T	9: 106,157,108		probably benign	Het
Gm37596	C	A	3: 93,692,112	V317L	probably benign	Het
Gm6430	T	C	1: 97,025,572		noncoding transcript	Het
Golga1	C	A	2: 39,019,641		probably null	Het
Gucy2g	A	T	19: 55,237,837	F216I	probably benign	Het
L3mbtl3	A	G	10: 26,313,884	V494A	unknown	Het
Lama2	AATCAGACAGGAG	A	10: 27,212,128		probably benign	Het
Lemd3	A	T	10: 120,925,430	L907Q	possibly damaging	Het
Lrp2	A	T	2: 69,502,517	V1552D	probably damaging	Het
Map3k12	T	C	15: 102,505,402	T45A	probably damaging	Het
Mycbp2	A	T	14: 103,287,228	D665E	probably damaging	Het
Myof	A	G	19: 37,922,978	S1502P	probably damaging	Het
Olfr1178	A	T	2: 88,392,083	M279L	probably benign	Het
Pcdhac2	G	T	18: 37,144,446	V160L	probably benign	Het
Pcnt	T	C	10: 76,374,870	E2473G	possibly damaging	Het
Pitpnm2	T	A	5: 124,152,615	I3L	possibly damaging	Het
Prkd3	C	A	17: 78,983,558	W176L	probably damaging	Het
Prpf39	C	T	12: 65,056,266	A438V	probably damaging	Het
Rpgrip1	T	A	14: 52,147,399	F655I	probably damaging	Het
Rrp12	T	C	19: 41,892,551	Y147C	probably damaging	Het
Sec23b	A	T	2: 144,574,718	N429Y	possibly damaging	Het
Slc2a10	T	A	2: 165,514,764	S115T	probably damaging	Het
Spg11	A	C	2: 122,075,332	D1277E	probably benign	Het
Sspo	A	G	6: 48,460,520	D1279G	probably damaging	Het
St18	T	C	1: 6,827,837	I621T	probably benign	Het
Tbc1d31	T	A	15: 57,920,042	D112E	possibly damaging	Het
Tgm4	A	T	9: 123,056,530	D379V	probably damaging	Het
Thyn1	A	T	9: 27,003,597	D15V	possibly damaging	Het
Tm4sf19	T	C	16: 32,407,894	V167A	possibly damaging	Het
Trim38	A	C	13: 23,791,491	Q471P	probably benign	Het
Trmt1	T	A	8: 84,697,755		probably benign	Het
Ubqlnl	C	T	7: 104,149,718	V191M	probably benign	Het
Usp9y	T	C	Y: 1,336,375	I1500V	probably benign	Het
Vgll4	C	T	6: 114,890,612		probably null	Het
Vmn1r173	T	A	7: 23,703,016	N225K	probably damaging	Het
Vmn2r22	C	T	6: 123,637,954	G226R	probably damaging	Het
Wnk3	C	A	X: 151,233,213	P555Q	probably benign	Het
Yes1	T	G	5: 32,640,585	Y83D	possibly damaging	Het
Zdhhc15	G	A	X: 104,560,688	R322*	probably null	Het

Other mutations in Cep135

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Cep135	APN	5	76601459	missense	probably damaging	0.98
IGL01154:Cep135	APN	5	76606796	splice site	probably benign
IGL01323:Cep135	APN	5	76591765	missense	probably benign	0.29
IGL01599:Cep135	APN	5	76593347	missense	possibly damaging	0.93
IGL01923:Cep135	APN	5	76640982	makesense	probably null
IGL02178:Cep135	APN	5	76595474	missense	probably damaging	1.00
IGL02276:Cep135	APN	5	76634246	missense	probably benign	0.00
IGL02344:Cep135	APN	5	76616821	missense	probably benign
IGL02394:Cep135	APN	5	76631471	missense	probably benign	0.02
IGL02740:Cep135	APN	5	76638268	critical splice donor site	probably null
IGL02832:Cep135	APN	5	76640949	missense	probably damaging	0.98
R0026:Cep135	UTSW	5	76606734	nonsense	probably null
R0060:Cep135	UTSW	5	76621350	missense	probably benign	0.20
R0325:Cep135	UTSW	5	76615743	missense	probably damaging	0.98
R0336:Cep135	UTSW	5	76601502	missense	probably benign	0.07
R0564:Cep135	UTSW	5	76615710	missense	probably damaging	1.00
R0564:Cep135	UTSW	5	76638949	missense	probably benign	0.03
R0600:Cep135	UTSW	5	76621305	missense	probably benign
R0636:Cep135	UTSW	5	76615657	missense	probably benign	0.07
R0704:Cep135	UTSW	5	76630949	missense	possibly damaging	0.62
R0835:Cep135	UTSW	5	76615706	missense	probably benign	0.40
R1015:Cep135	UTSW	5	76640997	critical splice donor site	probably null
R1167:Cep135	UTSW	5	76624637	missense	probably damaging	1.00
R1252:Cep135	UTSW	5	76594115	missense	possibly damaging	0.67
R1554:Cep135	UTSW	5	76634213	nonsense	probably null
R1770:Cep135	UTSW	5	76603195	missense	possibly damaging	0.95
R1804:Cep135	UTSW	5	76636932	missense	probably benign	0.22
R1968:Cep135	UTSW	5	76624747	missense	possibly damaging	0.96
R1987:Cep135	UTSW	5	76597428	missense	probably benign	0.00
R1996:Cep135	UTSW	5	76632266	missense	probably benign	0.08
R2004:Cep135	UTSW	5	76632329	critical splice donor site	probably null
R2178:Cep135	UTSW	5	76631450	missense	probably benign	0.00
R2305:Cep135	UTSW	5	76595389	splice site	probably benign
R2679:Cep135	UTSW	5	76624660	missense	probably benign
R3125:Cep135	UTSW	5	76621363	critical splice donor site	probably null
R3623:Cep135	UTSW	5	76624739	missense	probably benign	0.00
R4359:Cep135	UTSW	5	76611714	missense	possibly damaging	0.47
R4561:Cep135	UTSW	5	76638193	missense	possibly damaging	0.95
R4666:Cep135	UTSW	5	76616854	missense	probably benign
R4945:Cep135	UTSW	5	76597428	missense	probably benign	0.00
R5105:Cep135	UTSW	5	76594092	missense	probably benign	0.00
R5117:Cep135	UTSW	5	76631429	missense	probably benign	0.01
R5176:Cep135	UTSW	5	76637026	missense	probably benign	0.04
R5194:Cep135	UTSW	5	76615777	missense	probably benign	0.05
R5233:Cep135	UTSW	5	76591843	small deletion	probably benign
R5275:Cep135	UTSW	5	76593204	missense	possibly damaging	0.94
R5295:Cep135	UTSW	5	76593204	missense	possibly damaging	0.94
R5412:Cep135	UTSW	5	76616862	missense	probably benign	0.00
R5427:Cep135	UTSW	5	76638202	missense	probably benign	0.00
R5801:Cep135	UTSW	5	76630676	missense	probably damaging	1.00
R5975:Cep135	UTSW	5	76640890	missense	possibly damaging	0.94
R6087:Cep135	UTSW	5	76615791	critical splice donor site	probably null
R6176:Cep135	UTSW	5	76624643	missense	probably benign
R6210:Cep135	UTSW	5	76624723	missense	probably benign	0.15
R6456:Cep135	UTSW	5	76591724	start gained	probably benign
R6467:Cep135	UTSW	5	76621340	missense	possibly damaging	0.50
R6622:Cep135	UTSW	5	76640968	missense	probably benign	0.00
R6650:Cep135	UTSW	5	76633701	missense	possibly damaging	0.77
R6838:Cep135	UTSW	5	76632215	missense	probably damaging	1.00
R7028:Cep135	UTSW	5	76616848	missense	probably benign
R7049:Cep135	UTSW	5	76606738	missense	probably benign	0.01
R7095:Cep135	UTSW	5	76594058	missense	probably benign	0.10
R7207:Cep135	UTSW	5	76632243	missense	probably benign	0.00
R7330:Cep135	UTSW	5	76606745	nonsense	probably null
R7369:Cep135	UTSW	5	76593253	missense	possibly damaging	0.94
R7741:Cep135	UTSW	5	76630970	missense	probably damaging	0.99
R7850:Cep135	UTSW	5	76591873	critical splice donor site	probably null
R7869:Cep135	UTSW	5	76640956	missense	probably benign	0.00
R8303:Cep135	UTSW	5	76611728	missense	probably damaging	1.00
R8312:Cep135	UTSW	5	76636899	missense	probably damaging	1.00
Z1177:Cep135	UTSW	5	76591826	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CGCTGACATGTTGGTCCTAAG -3'
(R):5'- GCATACCCAGAAGAAGCATGTC -3'

Sequencing Primer
(F):5'- CTGGTCTACAAAGTGAGCTCCAG -3'
(R):5'- TACCCAGAAGAAGCATGTCACAGAG -3'

Posted On

2015-07-07