Incidental Mutation 'R4407:Pitpnm2'
ID327705
Institutional Source Beutler Lab
Gene Symbol Pitpnm2
Ensembl Gene ENSMUSG00000029406
Gene Namephosphatidylinositol transfer protein, membrane-associated 2
SynonymsNIR3, RDGBA2, Rdgb2
MMRRC Submission 041689-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4407 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location124118690-124249760 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 124152615 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 3 (I3L)
Ref Sequence ENSEMBL: ENSMUSP00000143269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086123] [ENSMUST00000159677] [ENSMUST00000161273] [ENSMUST00000161644] [ENSMUST00000161938] [ENSMUST00000162812]
Predicted Effect probably benign
Transcript: ENSMUST00000086123
AA Change: I3L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000083292
Gene: ENSMUSG00000029406
AA Change: I3L

DomainStartEndE-ValueType
Pfam:IP_trans 1 253 6.1e-132 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
low complexity region 507 515 N/A INTRINSIC
Blast:DDHD 548 570 6e-7 BLAST
low complexity region 571 589 N/A INTRINSIC
low complexity region 608 630 N/A INTRINSIC
low complexity region 682 689 N/A INTRINSIC
DDHD 701 895 1.66e-98 SMART
LNS2 1040 1171 3.22e-55 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159677
AA Change: I3L

PolyPhen 2 Score 0.572 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143269
Gene: ENSMUSG00000029406
AA Change: I3L

DomainStartEndE-ValueType
Pfam:IP_trans 1 253 3.2e-130 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
low complexity region 420 436 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161273
AA Change: I3L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000124292
Gene: ENSMUSG00000029406
AA Change: I3L

DomainStartEndE-ValueType
Pfam:IP_trans 1 253 3.2e-129 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
Blast:DDHD 422 670 2e-65 BLAST
low complexity region 682 689 N/A INTRINSIC
DDHD 701 945 7.5e-100 SMART
LNS2 1090 1221 3.1e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161644
AA Change: I3L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000161938
AA Change: I3L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000124111
Gene: ENSMUSG00000029406
AA Change: I3L

DomainStartEndE-ValueType
Pfam:IP_trans 1 251 7.5e-116 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
Blast:DDHD 422 670 2e-65 BLAST
low complexity region 682 689 N/A INTRINSIC
DDHD 701 949 8.37e-104 SMART
LNS2 1094 1225 3.22e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162812
AA Change: I3L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000124740
Gene: ENSMUSG00000029406
AA Change: I3L

DomainStartEndE-ValueType
Pfam:IP_trans 1 253 6.1e-132 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
low complexity region 507 515 N/A INTRINSIC
Blast:DDHD 548 570 6e-7 BLAST
low complexity region 571 589 N/A INTRINSIC
low complexity region 608 630 N/A INTRINSIC
low complexity region 682 689 N/A INTRINSIC
DDHD 701 895 1.66e-98 SMART
LNS2 1040 1171 3.22e-55 SMART
Meta Mutation Damage Score 0.1014 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PITPNM2 belongs to a family of membrane-associated phosphatidylinositol transfer domain-containing proteins that share homology with the Drosophila retinal degeneration B (rdgB) protein (Ocaka et al., 2005 [PubMed 15627748]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no defects pertaining to photoreceptor function or survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830035A12Rik T C 11: 107,532,055 noncoding transcript Het
Bbs10 A G 10: 111,299,859 T278A probably benign Het
BC053393 A G 11: 46,577,380 T94A probably damaging Het
Bcl6b A G 11: 70,226,103 L450P probably damaging Het
Braf T G 6: 39,615,720 K674Q probably damaging Het
Cep112 C T 11: 108,519,201 T481I possibly damaging Het
Cep135 T A 5: 76,624,667 M633K probably benign Het
Cpped1 T C 16: 11,805,421 Y278C probably damaging Het
Depdc5 T A 5: 32,904,534 probably null Het
Dolpp1 C T 2: 30,396,452 A128V possibly damaging Het
E2f5 T A 3: 14,603,763 D238E probably benign Het
Fat4 A T 3: 38,958,540 D2328V probably benign Het
Fbln1 T A 15: 85,231,556 probably null Het
Fkbp3 T C 12: 65,070,004 T53A probably damaging Het
Flg2 G T 3: 93,214,869 G1449C unknown Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Glyctk A T 9: 106,157,108 probably benign Het
Gm37596 C A 3: 93,692,112 V317L probably benign Het
Gm6430 T C 1: 97,025,572 noncoding transcript Het
Golga1 C A 2: 39,019,641 probably null Het
Gucy2g A T 19: 55,237,837 F216I probably benign Het
L3mbtl3 A G 10: 26,313,884 V494A unknown Het
Lama2 AATCAGACAGGAG A 10: 27,212,128 probably benign Het
Lemd3 A T 10: 120,925,430 L907Q possibly damaging Het
Lrp2 A T 2: 69,502,517 V1552D probably damaging Het
Map3k12 T C 15: 102,505,402 T45A probably damaging Het
Mycbp2 A T 14: 103,287,228 D665E probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Olfr1178 A T 2: 88,392,083 M279L probably benign Het
Pcdhac2 G T 18: 37,144,446 V160L probably benign Het
Pcnt T C 10: 76,374,870 E2473G possibly damaging Het
Prkd3 C A 17: 78,983,558 W176L probably damaging Het
Prpf39 C T 12: 65,056,266 A438V probably damaging Het
Rpgrip1 T A 14: 52,147,399 F655I probably damaging Het
Rrp12 T C 19: 41,892,551 Y147C probably damaging Het
Sec23b A T 2: 144,574,718 N429Y possibly damaging Het
Slc2a10 T A 2: 165,514,764 S115T probably damaging Het
Spg11 A C 2: 122,075,332 D1277E probably benign Het
Sspo A G 6: 48,460,520 D1279G probably damaging Het
St18 T C 1: 6,827,837 I621T probably benign Het
Tbc1d31 T A 15: 57,920,042 D112E possibly damaging Het
Tgm4 A T 9: 123,056,530 D379V probably damaging Het
Thyn1 A T 9: 27,003,597 D15V possibly damaging Het
Tm4sf19 T C 16: 32,407,894 V167A possibly damaging Het
Trim38 A C 13: 23,791,491 Q471P probably benign Het
Trmt1 T A 8: 84,697,755 probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Usp9y T C Y: 1,336,375 I1500V probably benign Het
Vgll4 C T 6: 114,890,612 probably null Het
Vmn1r173 T A 7: 23,703,016 N225K probably damaging Het
Vmn2r22 C T 6: 123,637,954 G226R probably damaging Het
Wnk3 C A X: 151,233,213 P555Q probably benign Het
Yes1 T G 5: 32,640,585 Y83D possibly damaging Het
Zdhhc15 G A X: 104,560,688 R322* probably null Het
Other mutations in Pitpnm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Pitpnm2 APN 5 124121663 unclassified probably benign
IGL01660:Pitpnm2 APN 5 124123194 missense probably damaging 1.00
IGL02328:Pitpnm2 APN 5 124121414 missense probably damaging 0.99
IGL02340:Pitpnm2 APN 5 124130613 missense probably damaging 1.00
IGL02399:Pitpnm2 APN 5 124140758 splice site probably benign
IGL02719:Pitpnm2 APN 5 124140602 missense probably damaging 1.00
IGL03053:Pitpnm2 APN 5 124143601 missense probably damaging 1.00
IGL03083:Pitpnm2 APN 5 124133382 missense possibly damaging 0.92
PIT4131001:Pitpnm2 UTSW 5 124131115 missense probably benign 0.01
R0058:Pitpnm2 UTSW 5 124124030 missense probably damaging 1.00
R0437:Pitpnm2 UTSW 5 124131089 splice site probably benign
R0530:Pitpnm2 UTSW 5 124131201 missense probably damaging 1.00
R0568:Pitpnm2 UTSW 5 124140517 splice site probably benign
R0926:Pitpnm2 UTSW 5 124131209 missense probably benign 0.10
R1625:Pitpnm2 UTSW 5 124133433 missense probably benign 0.05
R2008:Pitpnm2 UTSW 5 124152621 start codon destroyed probably damaging 0.99
R2120:Pitpnm2 UTSW 5 124127269 missense probably damaging 1.00
R2354:Pitpnm2 UTSW 5 124122919 missense probably damaging 0.99
R2448:Pitpnm2 UTSW 5 124123994 missense probably damaging 1.00
R2509:Pitpnm2 UTSW 5 124136326 missense probably damaging 0.99
R2510:Pitpnm2 UTSW 5 124136326 missense probably damaging 0.99
R2511:Pitpnm2 UTSW 5 124136326 missense probably damaging 0.99
R2520:Pitpnm2 UTSW 5 124129401 missense probably damaging 0.96
R2860:Pitpnm2 UTSW 5 124121437 missense probably damaging 1.00
R2861:Pitpnm2 UTSW 5 124121437 missense probably damaging 1.00
R4417:Pitpnm2 UTSW 5 124123569 missense probably damaging 1.00
R4426:Pitpnm2 UTSW 5 124142123 missense probably benign 0.32
R4458:Pitpnm2 UTSW 5 124121376 missense probably benign 0.00
R4610:Pitpnm2 UTSW 5 124125371 missense probably damaging 0.99
R4786:Pitpnm2 UTSW 5 124121743 nonsense probably null
R4903:Pitpnm2 UTSW 5 124152605 missense probably damaging 1.00
R5151:Pitpnm2 UTSW 5 124136386 missense probably damaging 1.00
R5315:Pitpnm2 UTSW 5 124121933 missense probably benign 0.18
R5592:Pitpnm2 UTSW 5 124142149 missense probably damaging 1.00
R5792:Pitpnm2 UTSW 5 124130321 nonsense probably null
R6846:Pitpnm2 UTSW 5 124131171 missense probably benign 0.00
R6983:Pitpnm2 UTSW 5 124133406 missense probably damaging 1.00
R7096:Pitpnm2 UTSW 5 124129261 missense possibly damaging 0.69
R7188:Pitpnm2 UTSW 5 124121303 missense probably benign 0.31
R7203:Pitpnm2 UTSW 5 124121459 missense probably damaging 0.96
R7237:Pitpnm2 UTSW 5 124125297 critical splice donor site probably null
R7257:Pitpnm2 UTSW 5 124125356 missense possibly damaging 0.88
R7622:Pitpnm2 UTSW 5 124122027 missense probably benign 0.39
R7677:Pitpnm2 UTSW 5 124123569 missense probably damaging 1.00
R7736:Pitpnm2 UTSW 5 124123030 missense possibly damaging 0.47
R7745:Pitpnm2 UTSW 5 124128705 missense probably benign 0.19
R8041:Pitpnm2 UTSW 5 124121456
Predicted Primers PCR Primer
(F):5'- TAAGGTGCAGCAGCTCACAG -3'
(R):5'- GGTAGCTCTTCAAGATTGCTCAG -3'

Sequencing Primer
(F):5'- GACACCGAAAGCAGTCCATGTC -3'
(R):5'- AGATTGCAGAAAGTGACTCTCC -3'
Posted On2015-07-07