Incidental Mutation 'R4407:Vmn2r22'
ID327709
Institutional Source Beutler Lab
Gene Symbol Vmn2r22
Ensembl Gene ENSMUSG00000095486
Gene Namevomeronasal 2, receptor 22
SynonymsEG546913
MMRRC Submission 041689-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R4407 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location123609758-123650635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 123637954 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 226 (G226R)
Ref Sequence ENSEMBL: ENSMUSP00000132043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170808]
Predicted Effect probably damaging
Transcript: ENSMUST00000170808
AA Change: G226R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132043
Gene: ENSMUSG00000095486
AA Change: G226R

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:ANF_receptor 81 473 1.4e-32 PFAM
Pfam:NCD3G 517 570 2.2e-23 PFAM
Pfam:7tm_3 601 838 1.2e-54 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830035A12Rik T C 11: 107,532,055 noncoding transcript Het
Bbs10 A G 10: 111,299,859 T278A probably benign Het
BC053393 A G 11: 46,577,380 T94A probably damaging Het
Bcl6b A G 11: 70,226,103 L450P probably damaging Het
Braf T G 6: 39,615,720 K674Q probably damaging Het
Cep112 C T 11: 108,519,201 T481I possibly damaging Het
Cep135 T A 5: 76,624,667 M633K probably benign Het
Cpped1 T C 16: 11,805,421 Y278C probably damaging Het
Depdc5 T A 5: 32,904,534 probably null Het
Dolpp1 C T 2: 30,396,452 A128V possibly damaging Het
E2f5 T A 3: 14,603,763 D238E probably benign Het
Fat4 A T 3: 38,958,540 D2328V probably benign Het
Fbln1 T A 15: 85,231,556 probably null Het
Fkbp3 T C 12: 65,070,004 T53A probably damaging Het
Flg2 G T 3: 93,214,869 G1449C unknown Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Glyctk A T 9: 106,157,108 probably benign Het
Gm37596 C A 3: 93,692,112 V317L probably benign Het
Gm6430 T C 1: 97,025,572 noncoding transcript Het
Golga1 C A 2: 39,019,641 probably null Het
Gucy2g A T 19: 55,237,837 F216I probably benign Het
L3mbtl3 A G 10: 26,313,884 V494A unknown Het
Lama2 AATCAGACAGGAG A 10: 27,212,128 probably benign Het
Lemd3 A T 10: 120,925,430 L907Q possibly damaging Het
Lrp2 A T 2: 69,502,517 V1552D probably damaging Het
Map3k12 T C 15: 102,505,402 T45A probably damaging Het
Mycbp2 A T 14: 103,287,228 D665E probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Olfr1178 A T 2: 88,392,083 M279L probably benign Het
Pcdhac2 G T 18: 37,144,446 V160L probably benign Het
Pcnt T C 10: 76,374,870 E2473G possibly damaging Het
Pitpnm2 T A 5: 124,152,615 I3L possibly damaging Het
Prkd3 C A 17: 78,983,558 W176L probably damaging Het
Prpf39 C T 12: 65,056,266 A438V probably damaging Het
Rpgrip1 T A 14: 52,147,399 F655I probably damaging Het
Rrp12 T C 19: 41,892,551 Y147C probably damaging Het
Sec23b A T 2: 144,574,718 N429Y possibly damaging Het
Slc2a10 T A 2: 165,514,764 S115T probably damaging Het
Spg11 A C 2: 122,075,332 D1277E probably benign Het
Sspo A G 6: 48,460,520 D1279G probably damaging Het
St18 T C 1: 6,827,837 I621T probably benign Het
Tbc1d31 T A 15: 57,920,042 D112E possibly damaging Het
Tgm4 A T 9: 123,056,530 D379V probably damaging Het
Thyn1 A T 9: 27,003,597 D15V possibly damaging Het
Tm4sf19 T C 16: 32,407,894 V167A possibly damaging Het
Trim38 A C 13: 23,791,491 Q471P probably benign Het
Trmt1 T A 8: 84,697,755 probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Usp9y T C Y: 1,336,375 I1500V probably benign Het
Vgll4 C T 6: 114,890,612 probably null Het
Vmn1r173 T A 7: 23,703,016 N225K probably damaging Het
Wnk3 C A X: 151,233,213 P555Q probably benign Het
Yes1 T G 5: 32,640,585 Y83D possibly damaging Het
Zdhhc15 G A X: 104,560,688 R322* probably null Het
Other mutations in Vmn2r22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Vmn2r22 APN 6 123638053 missense probably damaging 1.00
IGL01764:Vmn2r22 APN 6 123650420 critical splice donor site probably null
IGL02037:Vmn2r22 APN 6 123649067 missense probably damaging 1.00
IGL02183:Vmn2r22 APN 6 123638004 missense probably damaging 1.00
IGL02335:Vmn2r22 APN 6 123638092 missense probably damaging 0.99
IGL02440:Vmn2r22 APN 6 123637405 missense probably benign 0.00
IGL02663:Vmn2r22 APN 6 123649158 missense probably benign 0.11
IGL03101:Vmn2r22 APN 6 123637336 missense probably benign 0.09
R0266:Vmn2r22 UTSW 6 123637404 missense probably damaging 0.99
R0348:Vmn2r22 UTSW 6 123637725 missense probably damaging 1.00
R0780:Vmn2r22 UTSW 6 123637974 missense probably damaging 1.00
R0849:Vmn2r22 UTSW 6 123637404 missense probably damaging 0.99
R1074:Vmn2r22 UTSW 6 123649258 missense probably benign 0.02
R1456:Vmn2r22 UTSW 6 123637665 missense possibly damaging 0.86
R1719:Vmn2r22 UTSW 6 123637843 missense possibly damaging 0.68
R1989:Vmn2r22 UTSW 6 123637541 missense probably damaging 1.00
R2928:Vmn2r22 UTSW 6 123637443 missense probably damaging 0.96
R2939:Vmn2r22 UTSW 6 123637635 missense probably damaging 0.99
R3727:Vmn2r22 UTSW 6 123650625 missense possibly damaging 0.70
R3782:Vmn2r22 UTSW 6 123650632 nonsense probably null
R3873:Vmn2r22 UTSW 6 123637380 missense possibly damaging 0.68
R4344:Vmn2r22 UTSW 6 123637797 missense probably damaging 1.00
R4428:Vmn2r22 UTSW 6 123637858 missense possibly damaging 0.47
R4430:Vmn2r22 UTSW 6 123637858 missense possibly damaging 0.47
R4431:Vmn2r22 UTSW 6 123637858 missense possibly damaging 0.47
R4701:Vmn2r22 UTSW 6 123650469 missense probably benign 0.00
R5274:Vmn2r22 UTSW 6 123650634 start codon destroyed probably null 0.93
R5668:Vmn2r22 UTSW 6 123637914 missense probably benign 0.06
R5776:Vmn2r22 UTSW 6 123637714 missense probably damaging 1.00
R6416:Vmn2r22 UTSW 6 123637738 missense probably damaging 1.00
R7788:Vmn2r22 UTSW 6 123637600 missense not run
Predicted Primers PCR Primer
(F):5'- GCCAGAAGAGAATATGTGTCACC -3'
(R):5'- TTCTCCTAGAGTGCATTAAGAGAAGAG -3'

Sequencing Primer
(F):5'- CAAATGCAATGATAACACGTGTC -3'
(R):5'- AGAGAAGAGGTAAACCAAATCATTTG -3'
Posted On2015-07-07