Incidental Mutation 'R0045:Myl3'
ID32771
Institutional Source Beutler Lab
Gene Symbol Myl3
Ensembl Gene ENSMUSG00000059741
Gene Namemyosin, light polypeptide 3
SynonymsMLC1v, alkali, slow skeletal, MLC1s, Mylc, ventricular
MMRRC Submission 038339-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.387) question?
Stock #R0045 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location110741861-110769798 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 110767929 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 119 (D119A)
Ref Sequence ENSEMBL: ENSMUSP00000142530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079784] [ENSMUST00000124267] [ENSMUST00000136695] [ENSMUST00000200011]
Predicted Effect probably damaging
Transcript: ENSMUST00000079784
AA Change: D119A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078715
Gene: ENSMUSG00000059741
AA Change: D119A

DomainStartEndE-ValueType
low complexity region 2 45 N/A INTRINSIC
internal_repeat_1 61 124 1.28e-5 PROSPERO
internal_repeat_1 140 198 1.28e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000124267
AA Change: D42A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142424
Gene: ENSMUSG00000059741
AA Change: D42A

DomainStartEndE-ValueType
SCOP:d1ggwa_ 1 127 2e-23 SMART
PDB:1W7J|B 2 126 3e-68 PDB
Blast:EFh 64 92 5e-12 BLAST
Blast:EFh 99 126 2e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000136695
AA Change: D42A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142791
Gene: ENSMUSG00000059741
AA Change: D42A

DomainStartEndE-ValueType
SCOP:d1ggwa_ 1 127 2e-23 SMART
PDB:1W7J|B 2 126 3e-68 PDB
Blast:EFh 64 92 5e-12 BLAST
Blast:EFh 99 126 2e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153142
Predicted Effect probably damaging
Transcript: ENSMUST00000200011
AA Change: D119A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142530
Gene: ENSMUSG00000059741
AA Change: D119A

DomainStartEndE-ValueType
low complexity region 2 45 N/A INTRINSIC
Pfam:EF-hand_6 62 93 4.7e-3 PFAM
internal_repeat_1 140 182 5.24e-5 PROSPERO
Meta Mutation Damage Score 0.3993 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MYL3 encodes myosin light chain 3, an alkali light chain also referred to in the literature as both the ventricular isoform and the slow skeletal muscle isoform. Mutations in MYL3 have been identified as a cause of mid-left ventricular chamber type hypertrophic cardiomyopathy. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,082,085 N299S probably damaging Het
Abi3 A G 11: 95,832,715 *368R probably null Het
Agbl1 T C 7: 76,698,840 probably null Het
Ap3b2 T C 7: 81,466,193 D650G possibly damaging Het
Arhgap30 A G 1: 171,408,430 S791G probably benign Het
Arvcf T A 16: 18,403,458 L722Q probably benign Het
Ascc3 C T 10: 50,718,402 R1198* probably null Het
Atf2 G T 2: 73,829,856 T189N probably benign Het
Atf7ip A G 6: 136,559,816 K16E probably damaging Het
Atg9b G T 5: 24,387,398 Q621K probably damaging Het
Atp12a G A 14: 56,372,873 E234K probably damaging Het
C8a T C 4: 104,826,815 K368E probably benign Het
Cdh23 T C 10: 60,530,978 Y241C probably damaging Het
Cdon G A 9: 35,486,807 S940N probably benign Het
Cds2 G T 2: 132,305,155 G402V possibly damaging Het
Cog6 T C 3: 52,992,750 probably null Het
Commd10 T C 18: 46,967,836 S114P possibly damaging Het
Dram2 T C 3: 106,570,817 V155A possibly damaging Het
Egr2 T A 10: 67,540,480 V252E probably benign Het
Exoc3l C T 8: 105,293,685 V203M probably damaging Het
Fsip1 C A 2: 118,248,292 probably null Het
Gm10840 C A 11: 106,161,100 probably benign Het
Gm8251 T C 1: 44,057,205 K1578E probably benign Het
Gpr37l1 A G 1: 135,161,145 L394P probably damaging Het
Gsap T C 5: 21,226,832 M243T possibly damaging Het
Hsd3b5 T A 3: 98,619,144 I329F probably benign Het
Htra1 T A 7: 130,961,532 S164R probably damaging Het
Il17b G A 18: 61,690,244 V50M probably damaging Het
Itga4 A T 2: 79,301,031 Y581F probably damaging Het
Jmjd8 A G 17: 25,829,281 E92G probably damaging Het
Kcnq4 T A 4: 120,697,955 D677V probably damaging Het
Klhl42 A G 6: 147,092,168 T213A probably benign Het
Lcn5 T C 2: 25,660,698 S133P probably damaging Het
Liph T C 16: 21,968,053 Y271C probably damaging Het
Lpcat3 T C 6: 124,701,474 I228T probably benign Het
Lrrd1 A G 5: 3,866,418 K812E possibly damaging Het
Ltbp2 G A 12: 84,809,587 T701I probably damaging Het
Ltbp2 T C 12: 84,813,288 T631A probably damaging Het
Mavs G A 2: 131,238,831 R13Q probably damaging Het
Mtor C G 4: 148,464,949 H597D probably benign Het
Muc5b T A 7: 141,856,818 H1309Q unknown Het
Nnat A T 2: 157,560,488 probably benign Het
Olfr183 G A 16: 59,000,491 D269N probably benign Het
Olfr293 T C 7: 86,664,340 L226S possibly damaging Het
Olfr703 T A 7: 106,845,389 Y259* probably null Het
Olfr869 A T 9: 20,137,191 Q25L probably benign Het
Pclo C T 5: 14,539,471 A595V unknown Het
Pcsk6 T A 7: 65,962,928 C315S probably damaging Het
Pkd2 T A 5: 104,455,805 probably benign Het
Ppp2r3c T A 12: 55,293,821 I155F probably damaging Het
Rapgef4 A G 2: 72,198,778 H398R possibly damaging Het
Ripor2 A G 13: 24,694,226 D328G probably damaging Het
Rpgrip1 A T 14: 52,141,144 T509S possibly damaging Het
Sh3pxd2a A G 19: 47,267,183 I1032T probably damaging Het
Slc25a13 A T 6: 6,109,277 S362T probably benign Het
Stk35 A T 2: 129,800,568 R10* probably null Het
Tal1 A G 4: 115,068,565 D277G probably damaging Het
Tecta G A 9: 42,375,191 T723I probably damaging Het
Trp53bp1 A C 2: 121,204,497 V103G probably benign Het
Trpv4 A G 5: 114,636,457 S189P probably benign Het
Ttll5 T G 12: 85,879,359 probably benign Het
Usp8 A G 2: 126,742,223 T451A probably benign Het
Vac14 G A 8: 110,636,952 D340N probably benign Het
Vars C A 17: 34,998,066 A471S probably benign Het
Vars A T 17: 35,010,619 H404L probably damaging Het
Vmn2r70 T C 7: 85,566,044 N94S probably damaging Het
Vpreb2 T C 16: 17,980,767 L39P probably damaging Het
Vps13a A T 19: 16,640,810 L693* probably null Het
Wapl A G 14: 34,733,794 I176V probably benign Het
Wdr31 G T 4: 62,464,033 L4I possibly damaging Het
Other mutations in Myl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00822:Myl3 APN 9 110766489 missense possibly damaging 0.95
IGL01292:Myl3 APN 9 110767977 missense probably damaging 1.00
IGL02814:Myl3 APN 9 110767991 nonsense probably null
R0009:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0010:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0015:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0040:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0045:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0080:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0081:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0095:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0194:Myl3 UTSW 9 110769121 missense probably benign 0.00
R1938:Myl3 UTSW 9 110766734 missense probably damaging 1.00
R2230:Myl3 UTSW 9 110767911 missense probably damaging 1.00
R2231:Myl3 UTSW 9 110767911 missense probably damaging 1.00
R2315:Myl3 UTSW 9 110766741 missense probably damaging 1.00
R3884:Myl3 UTSW 9 110767959 missense probably damaging 1.00
R5473:Myl3 UTSW 9 110767958 missense probably damaging 1.00
R7059:Myl3 UTSW 9 110742037 splice site probably benign
Predicted Primers PCR Primer
(F):5'- ACCAGGCGTTCCTAAGTAGACCATC -3'
(R):5'- TGGTCAAGTGACACAAAGGTTTCCC -3'

Sequencing Primer
(F):5'- GTTCCTAAGTAGACCATCAGGGC -3'
(R):5'- CTAGGACATCCCAGAGAAAGAG -3'
Posted On2013-05-09