Mutagenetix > Incidental Mutation

Incidental Mutation 'R4407:Cep112'

327724

Institutional Source

Beutler Lab

Gene Symbol

Cep112

Ensembl Gene

ENSMUSG00000020728

Gene Name

centrosomal protein 112

Synonyms

Macoco, 8430407H02Rik, Ccdc46, 1700001M19Rik, 1700029K01Rik

MMRRC Submission

041689-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.559) question?

Stock #

R4407 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108425192-108860615 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 108519201 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 481 (T481I)

Ref Sequence

ENSEMBL: ENSMUSP00000117192 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061287] [ENSMUST00000130515] [ENSMUST00000133670] [ENSMUST00000138538] [ENSMUST00000150863] [ENSMUST00000182729]

AlphaFold

Q5PR68

Predicted Effect

probably benign
Transcript: ENSMUST00000061287
AA Change: T481I

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000050597
Gene: ENSMUSG00000020728
AA Change: T481I

Domain	Start	End	E-Value	Type
Pfam:DUF4485	13	98	4.8e-31	PFAM
coiled coil region	275	341	N/A	INTRINSIC
coiled coil region	397	477	N/A	INTRINSIC
coiled coil region	504	954	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000130515
AA Change: T481I

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000114569
Gene: ENSMUSG00000020728
AA Change: T481I

Domain	Start	End	E-Value	Type
Pfam:DUF4485	12	99	5.8e-31	PFAM
coiled coil region	275	341	N/A	INTRINSIC
coiled coil region	397	477	N/A	INTRINSIC
coiled coil region	504	954	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000133670
AA Change: T207I

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000114627
Gene: ENSMUSG00000020728
AA Change: T207I

Domain	Start	End	E-Value	Type
low complexity region	10	29	N/A	INTRINSIC
internal_repeat_2	66	104	4.9e-5	PROSPERO
internal_repeat_1	81	110	2.63e-5	PROSPERO
coiled coil region	123	203	N/A	INTRINSIC
internal_repeat_3	252	264	4.9e-5	PROSPERO
low complexity region	317	328	N/A	INTRINSIC
internal_repeat_2	332	370	4.9e-5	PROSPERO
internal_repeat_3	532	544	4.9e-5	PROSPERO
internal_repeat_1	540	569	2.63e-5	PROSPERO
coiled coil region	571	609	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000138538
AA Change: T481I

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000117192
Gene: ENSMUSG00000020728
AA Change: T481I

Domain	Start	End	E-Value	Type
Pfam:DUF4485	12	99	6.7e-28	PFAM
coiled coil region	275	341	N/A	INTRINSIC
coiled coil region	397	477	N/A	INTRINSIC
coiled coil region	504	532	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000150863
AA Change: T533I

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000122509
Gene: ENSMUSG00000020728
AA Change: T533I

Domain	Start	End	E-Value	Type
Pfam:DUF4485	12	99	6.8e-28	PFAM
coiled coil region	275	341	N/A	INTRINSIC
coiled coil region	397	477	N/A	INTRINSIC
coiled coil region	504	566	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000182729
AA Change: T439I

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000138235
Gene: ENSMUSG00000020728
AA Change: T439I

Domain	Start	End	E-Value	Type
Pfam:DUF4485	12	99	5.4e-31	PFAM
coiled coil region	233	299	N/A	INTRINSIC
coiled coil region	355	435	N/A	INTRINSIC
coiled coil region	462	912	N/A	INTRINSIC

Meta Mutation Damage Score

0.0628

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain containing protein that belongs to the cell division control protein 42 effector protein family. In neurons, it localizes to the cytoplasm of dendrites and is also enriched in the nucleus where it interacts with the RNA polymerase III transcriptional repressor Maf1 to regulate gamma-aminobutyric acid A receptor surface expression. In addition, the protein has been identified as a component of the human centrosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830035A12Rik	T	C	11: 107,532,055		noncoding transcript	Het
Bbs10	A	G	10: 111,299,859	T278A	probably benign	Het
BC053393	A	G	11: 46,577,380	T94A	probably damaging	Het
Bcl6b	A	G	11: 70,226,103	L450P	probably damaging	Het
Braf	T	G	6: 39,615,720	K674Q	probably damaging	Het
Cep135	T	A	5: 76,624,667	M633K	probably benign	Het
Cpped1	T	C	16: 11,805,421	Y278C	probably damaging	Het
Depdc5	T	A	5: 32,904,534		probably null	Het
Dolpp1	C	T	2: 30,396,452	A128V	possibly damaging	Het
E2f5	T	A	3: 14,603,763	D238E	probably benign	Het
Fat4	A	T	3: 38,958,540	D2328V	probably benign	Het
Fbln1	T	A	15: 85,231,556		probably null	Het
Fkbp3	T	C	12: 65,070,004	T53A	probably damaging	Het
Flg2	G	T	3: 93,214,869	G1449C	unknown	Het
G530012D18Rik	G	C	1: 85,577,202		probably benign	Het
Glyctk	A	T	9: 106,157,108		probably benign	Het
Gm37596	C	A	3: 93,692,112	V317L	probably benign	Het
Gm6430	T	C	1: 97,025,572		noncoding transcript	Het
Golga1	C	A	2: 39,019,641		probably null	Het
Gucy2g	A	T	19: 55,237,837	F216I	probably benign	Het
L3mbtl3	A	G	10: 26,313,884	V494A	unknown	Het
Lama2	AATCAGACAGGAG	A	10: 27,212,128		probably benign	Het
Lemd3	A	T	10: 120,925,430	L907Q	possibly damaging	Het
Lrp2	A	T	2: 69,502,517	V1552D	probably damaging	Het
Map3k12	T	C	15: 102,505,402	T45A	probably damaging	Het
Mycbp2	A	T	14: 103,287,228	D665E	probably damaging	Het
Myof	A	G	19: 37,922,978	S1502P	probably damaging	Het
Olfr1178	A	T	2: 88,392,083	M279L	probably benign	Het
Pcdhac2	G	T	18: 37,144,446	V160L	probably benign	Het
Pcnt	T	C	10: 76,374,870	E2473G	possibly damaging	Het
Pitpnm2	T	A	5: 124,152,615	I3L	possibly damaging	Het
Prkd3	C	A	17: 78,983,558	W176L	probably damaging	Het
Prpf39	C	T	12: 65,056,266	A438V	probably damaging	Het
Rpgrip1	T	A	14: 52,147,399	F655I	probably damaging	Het
Rrp12	T	C	19: 41,892,551	Y147C	probably damaging	Het
Sec23b	A	T	2: 144,574,718	N429Y	possibly damaging	Het
Slc2a10	T	A	2: 165,514,764	S115T	probably damaging	Het
Spg11	A	C	2: 122,075,332	D1277E	probably benign	Het
Sspo	A	G	6: 48,460,520	D1279G	probably damaging	Het
St18	T	C	1: 6,827,837	I621T	probably benign	Het
Tbc1d31	T	A	15: 57,920,042	D112E	possibly damaging	Het
Tgm4	A	T	9: 123,056,530	D379V	probably damaging	Het
Thyn1	A	T	9: 27,003,597	D15V	possibly damaging	Het
Tm4sf19	T	C	16: 32,407,894	V167A	possibly damaging	Het
Trim38	A	C	13: 23,791,491	Q471P	probably benign	Het
Trmt1	T	A	8: 84,697,755		probably benign	Het
Ubqlnl	C	T	7: 104,149,718	V191M	probably benign	Het
Usp9y	T	C	Y: 1,336,375	I1500V	probably benign	Het
Vgll4	C	T	6: 114,890,612		probably null	Het
Vmn1r173	T	A	7: 23,703,016	N225K	probably damaging	Het
Vmn2r22	C	T	6: 123,637,954	G226R	probably damaging	Het
Wnk3	C	A	X: 151,233,213	P555Q	probably benign	Het
Yes1	T	G	5: 32,640,585	Y83D	possibly damaging	Het
Zdhhc15	G	A	X: 104,560,688	R322*	probably null	Het

Other mutations in Cep112

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00679:Cep112	APN	11	108591053	missense	probably damaging	1.00
IGL00705:Cep112	APN	11	108472033	missense	probably benign
IGL00848:Cep112	APN	11	108472060	missense	probably damaging	1.00
IGL00975:Cep112	APN	11	108434186	missense	probably damaging	1.00
IGL01085:Cep112	APN	11	108486606	missense	probably damaging	1.00
IGL01286:Cep112	APN	11	108859409	critical splice donor site	probably null
IGL01536:Cep112	APN	11	108531411	missense	probably null	0.08
IGL02622:Cep112	APN	11	108518683	missense	probably benign	0.26
IGL02720:Cep112	APN	11	108859351	missense	probably damaging	0.98
FR4976:Cep112	UTSW	11	108425352	unclassified	probably benign
PIT4466001:Cep112	UTSW	11	108519896	missense	probably benign
R0727:Cep112	UTSW	11	108506554	missense	probably damaging	1.00
R0907:Cep112	UTSW	11	108570432	splice site	probably benign
R0908:Cep112	UTSW	11	108664497	missense	possibly damaging	0.69
R1236:Cep112	UTSW	11	108859374	missense	probably damaging	1.00
R1514:Cep112	UTSW	11	108472054	missense	probably damaging	1.00
R2049:Cep112	UTSW	11	108606325	missense	probably damaging	0.96
R2058:Cep112	UTSW	11	108519261	critical splice donor site	probably null
R2059:Cep112	UTSW	11	108519261	critical splice donor site	probably null
R2126:Cep112	UTSW	11	108508258	missense	probably damaging	0.98
R2142:Cep112	UTSW	11	108606325	missense	probably damaging	0.96
R2196:Cep112	UTSW	11	108570361	missense	probably damaging	0.98
R2276:Cep112	UTSW	11	108855845	missense	probably damaging	1.00
R2414:Cep112	UTSW	11	108752582	missense	possibly damaging	0.91
R2655:Cep112	UTSW	11	108437201	splice site	probably benign
R2882:Cep112	UTSW	11	108519212	missense	possibly damaging	0.94
R3001:Cep112	UTSW	11	108440503	missense	probably damaging	1.00
R3002:Cep112	UTSW	11	108440503	missense	probably damaging	1.00
R3003:Cep112	UTSW	11	108440503	missense	probably damaging	1.00
R4796:Cep112	UTSW	11	108486992	critical splice donor site	probably null
R4898:Cep112	UTSW	11	108506645	missense	probably damaging	0.96
R4899:Cep112	UTSW	11	108606284	missense	probably damaging	0.96
R4977:Cep112	UTSW	11	108434236	missense	probably damaging	0.97
R5021:Cep112	UTSW	11	108470328	missense	possibly damaging	0.86
R5186:Cep112	UTSW	11	108752560	missense	probably benign	0.00
R5462:Cep112	UTSW	11	108518744	missense	probably damaging	1.00
R5494:Cep112	UTSW	11	108664605	missense	probably damaging	1.00
R5506:Cep112	UTSW	11	108664603	missense	probably damaging	1.00
R5560:Cep112	UTSW	11	108437235	missense	probably damaging	1.00
R5682:Cep112	UTSW	11	108470312	missense	probably damaging	1.00
R5857:Cep112	UTSW	11	108531471	splice site	probably benign
R5863:Cep112	UTSW	11	108606232	missense	probably damaging	1.00
R5884:Cep112	UTSW	11	108570316	missense	probably damaging	0.99
R5913:Cep112	UTSW	11	108757688	missense	probably damaging	0.99
R6344:Cep112	UTSW	11	108519174	missense	probably damaging	0.98
R6498:Cep112	UTSW	11	108440531	missense	probably benign	0.25
R6611:Cep112	UTSW	11	108506551	missense	possibly damaging	0.71
R6638:Cep112	UTSW	11	108855870	missense	probably damaging	1.00
R6916:Cep112	UTSW	11	108859376	missense	probably damaging	1.00
R7182:Cep112	UTSW	11	108682844	missense	probably benign	0.07
R7262:Cep112	UTSW	11	108664641	missense	probably damaging	0.99
R7386:Cep112	UTSW	11	108808681	missense	probably benign	0.00
R7539:Cep112	UTSW	11	108855828	missense	probably benign	0.38
R8262:Cep112	UTSW	11	108503151	missense	probably damaging	1.00
R8681:Cep112	UTSW	11	108425652	critical splice donor site	probably null
R8845:Cep112	UTSW	11	108570367	missense	probably damaging	1.00
R8955:Cep112	UTSW	11	108752434	missense	possibly damaging	0.61
R9213:Cep112	UTSW	11	108486953	missense	probably benign
R9348:Cep112	UTSW	11	108437250	missense	probably damaging	0.97
R9516:Cep112	UTSW	11	108757688	missense	probably damaging	0.99
R9771:Cep112	UTSW	11	108682691	intron	probably benign
R9784:Cep112	UTSW	11	108570391	missense	probably damaging	1.00
Z1176:Cep112	UTSW	11	108425310	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GATCTGCGAGTGGGTTAGAC -3'
(R):5'- AGCACCCTAGACAGCATAGTG -3'

Sequencing Primer
(F):5'- CTTATGATGTTCCTACCTAAGTGGG -3'
(R):5'- CCCTAGACAGCATAGTGTGTTTTGAC -3'

Posted On

2015-07-07