Incidental Mutation 'R4407:Cep112'
ID 327724
Institutional Source Beutler Lab
Gene Symbol Cep112
Ensembl Gene ENSMUSG00000020728
Gene Name centrosomal protein 112
Synonyms Macoco, 8430407H02Rik, Ccdc46, 1700001M19Rik, 1700029K01Rik
MMRRC Submission 041689-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.559) question?
Stock # R4407 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 108425192-108860615 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 108519201 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 481 (T481I)
Ref Sequence ENSEMBL: ENSMUSP00000117192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061287] [ENSMUST00000130515] [ENSMUST00000133670] [ENSMUST00000138538] [ENSMUST00000150863] [ENSMUST00000182729]
AlphaFold Q5PR68
Predicted Effect probably benign
Transcript: ENSMUST00000061287
AA Change: T481I

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000050597
Gene: ENSMUSG00000020728
AA Change: T481I

DomainStartEndE-ValueType
Pfam:DUF4485 13 98 4.8e-31 PFAM
coiled coil region 275 341 N/A INTRINSIC
coiled coil region 397 477 N/A INTRINSIC
coiled coil region 504 954 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130515
AA Change: T481I

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114569
Gene: ENSMUSG00000020728
AA Change: T481I

DomainStartEndE-ValueType
Pfam:DUF4485 12 99 5.8e-31 PFAM
coiled coil region 275 341 N/A INTRINSIC
coiled coil region 397 477 N/A INTRINSIC
coiled coil region 504 954 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000133670
AA Change: T207I

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114627
Gene: ENSMUSG00000020728
AA Change: T207I

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
internal_repeat_2 66 104 4.9e-5 PROSPERO
internal_repeat_1 81 110 2.63e-5 PROSPERO
coiled coil region 123 203 N/A INTRINSIC
internal_repeat_3 252 264 4.9e-5 PROSPERO
low complexity region 317 328 N/A INTRINSIC
internal_repeat_2 332 370 4.9e-5 PROSPERO
internal_repeat_3 532 544 4.9e-5 PROSPERO
internal_repeat_1 540 569 2.63e-5 PROSPERO
coiled coil region 571 609 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000138538
AA Change: T481I

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117192
Gene: ENSMUSG00000020728
AA Change: T481I

DomainStartEndE-ValueType
Pfam:DUF4485 12 99 6.7e-28 PFAM
coiled coil region 275 341 N/A INTRINSIC
coiled coil region 397 477 N/A INTRINSIC
coiled coil region 504 532 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000150863
AA Change: T533I

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122509
Gene: ENSMUSG00000020728
AA Change: T533I

DomainStartEndE-ValueType
Pfam:DUF4485 12 99 6.8e-28 PFAM
coiled coil region 275 341 N/A INTRINSIC
coiled coil region 397 477 N/A INTRINSIC
coiled coil region 504 566 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000182729
AA Change: T439I

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138235
Gene: ENSMUSG00000020728
AA Change: T439I

DomainStartEndE-ValueType
Pfam:DUF4485 12 99 5.4e-31 PFAM
coiled coil region 233 299 N/A INTRINSIC
coiled coil region 355 435 N/A INTRINSIC
coiled coil region 462 912 N/A INTRINSIC
Meta Mutation Damage Score 0.0628 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain containing protein that belongs to the cell division control protein 42 effector protein family. In neurons, it localizes to the cytoplasm of dendrites and is also enriched in the nucleus where it interacts with the RNA polymerase III transcriptional repressor Maf1 to regulate gamma-aminobutyric acid A receptor surface expression. In addition, the protein has been identified as a component of the human centrosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830035A12Rik T C 11: 107,532,055 noncoding transcript Het
Bbs10 A G 10: 111,299,859 T278A probably benign Het
BC053393 A G 11: 46,577,380 T94A probably damaging Het
Bcl6b A G 11: 70,226,103 L450P probably damaging Het
Braf T G 6: 39,615,720 K674Q probably damaging Het
Cep135 T A 5: 76,624,667 M633K probably benign Het
Cpped1 T C 16: 11,805,421 Y278C probably damaging Het
Depdc5 T A 5: 32,904,534 probably null Het
Dolpp1 C T 2: 30,396,452 A128V possibly damaging Het
E2f5 T A 3: 14,603,763 D238E probably benign Het
Fat4 A T 3: 38,958,540 D2328V probably benign Het
Fbln1 T A 15: 85,231,556 probably null Het
Fkbp3 T C 12: 65,070,004 T53A probably damaging Het
Flg2 G T 3: 93,214,869 G1449C unknown Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Glyctk A T 9: 106,157,108 probably benign Het
Gm37596 C A 3: 93,692,112 V317L probably benign Het
Gm6430 T C 1: 97,025,572 noncoding transcript Het
Golga1 C A 2: 39,019,641 probably null Het
Gucy2g A T 19: 55,237,837 F216I probably benign Het
L3mbtl3 A G 10: 26,313,884 V494A unknown Het
Lama2 AATCAGACAGGAG A 10: 27,212,128 probably benign Het
Lemd3 A T 10: 120,925,430 L907Q possibly damaging Het
Lrp2 A T 2: 69,502,517 V1552D probably damaging Het
Map3k12 T C 15: 102,505,402 T45A probably damaging Het
Mycbp2 A T 14: 103,287,228 D665E probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Olfr1178 A T 2: 88,392,083 M279L probably benign Het
Pcdhac2 G T 18: 37,144,446 V160L probably benign Het
Pcnt T C 10: 76,374,870 E2473G possibly damaging Het
Pitpnm2 T A 5: 124,152,615 I3L possibly damaging Het
Prkd3 C A 17: 78,983,558 W176L probably damaging Het
Prpf39 C T 12: 65,056,266 A438V probably damaging Het
Rpgrip1 T A 14: 52,147,399 F655I probably damaging Het
Rrp12 T C 19: 41,892,551 Y147C probably damaging Het
Sec23b A T 2: 144,574,718 N429Y possibly damaging Het
Slc2a10 T A 2: 165,514,764 S115T probably damaging Het
Spg11 A C 2: 122,075,332 D1277E probably benign Het
Sspo A G 6: 48,460,520 D1279G probably damaging Het
St18 T C 1: 6,827,837 I621T probably benign Het
Tbc1d31 T A 15: 57,920,042 D112E possibly damaging Het
Tgm4 A T 9: 123,056,530 D379V probably damaging Het
Thyn1 A T 9: 27,003,597 D15V possibly damaging Het
Tm4sf19 T C 16: 32,407,894 V167A possibly damaging Het
Trim38 A C 13: 23,791,491 Q471P probably benign Het
Trmt1 T A 8: 84,697,755 probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Usp9y T C Y: 1,336,375 I1500V probably benign Het
Vgll4 C T 6: 114,890,612 probably null Het
Vmn1r173 T A 7: 23,703,016 N225K probably damaging Het
Vmn2r22 C T 6: 123,637,954 G226R probably damaging Het
Wnk3 C A X: 151,233,213 P555Q probably benign Het
Yes1 T G 5: 32,640,585 Y83D possibly damaging Het
Zdhhc15 G A X: 104,560,688 R322* probably null Het
Other mutations in Cep112
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Cep112 APN 11 108591053 missense probably damaging 1.00
IGL00705:Cep112 APN 11 108472033 missense probably benign
IGL00848:Cep112 APN 11 108472060 missense probably damaging 1.00
IGL00975:Cep112 APN 11 108434186 missense probably damaging 1.00
IGL01085:Cep112 APN 11 108486606 missense probably damaging 1.00
IGL01286:Cep112 APN 11 108859409 critical splice donor site probably null
IGL01536:Cep112 APN 11 108531411 missense probably null 0.08
IGL02622:Cep112 APN 11 108518683 missense probably benign 0.26
IGL02720:Cep112 APN 11 108859351 missense probably damaging 0.98
FR4976:Cep112 UTSW 11 108425352 unclassified probably benign
PIT4466001:Cep112 UTSW 11 108519896 missense probably benign
R0727:Cep112 UTSW 11 108506554 missense probably damaging 1.00
R0907:Cep112 UTSW 11 108570432 splice site probably benign
R0908:Cep112 UTSW 11 108664497 missense possibly damaging 0.69
R1236:Cep112 UTSW 11 108859374 missense probably damaging 1.00
R1514:Cep112 UTSW 11 108472054 missense probably damaging 1.00
R2049:Cep112 UTSW 11 108606325 missense probably damaging 0.96
R2058:Cep112 UTSW 11 108519261 critical splice donor site probably null
R2059:Cep112 UTSW 11 108519261 critical splice donor site probably null
R2126:Cep112 UTSW 11 108508258 missense probably damaging 0.98
R2142:Cep112 UTSW 11 108606325 missense probably damaging 0.96
R2196:Cep112 UTSW 11 108570361 missense probably damaging 0.98
R2276:Cep112 UTSW 11 108855845 missense probably damaging 1.00
R2414:Cep112 UTSW 11 108752582 missense possibly damaging 0.91
R2655:Cep112 UTSW 11 108437201 splice site probably benign
R2882:Cep112 UTSW 11 108519212 missense possibly damaging 0.94
R3001:Cep112 UTSW 11 108440503 missense probably damaging 1.00
R3002:Cep112 UTSW 11 108440503 missense probably damaging 1.00
R3003:Cep112 UTSW 11 108440503 missense probably damaging 1.00
R4796:Cep112 UTSW 11 108486992 critical splice donor site probably null
R4898:Cep112 UTSW 11 108506645 missense probably damaging 0.96
R4899:Cep112 UTSW 11 108606284 missense probably damaging 0.96
R4977:Cep112 UTSW 11 108434236 missense probably damaging 0.97
R5021:Cep112 UTSW 11 108470328 missense possibly damaging 0.86
R5186:Cep112 UTSW 11 108752560 missense probably benign 0.00
R5462:Cep112 UTSW 11 108518744 missense probably damaging 1.00
R5494:Cep112 UTSW 11 108664605 missense probably damaging 1.00
R5506:Cep112 UTSW 11 108664603 missense probably damaging 1.00
R5560:Cep112 UTSW 11 108437235 missense probably damaging 1.00
R5682:Cep112 UTSW 11 108470312 missense probably damaging 1.00
R5857:Cep112 UTSW 11 108531471 splice site probably benign
R5863:Cep112 UTSW 11 108606232 missense probably damaging 1.00
R5884:Cep112 UTSW 11 108570316 missense probably damaging 0.99
R5913:Cep112 UTSW 11 108757688 missense probably damaging 0.99
R6344:Cep112 UTSW 11 108519174 missense probably damaging 0.98
R6498:Cep112 UTSW 11 108440531 missense probably benign 0.25
R6611:Cep112 UTSW 11 108506551 missense possibly damaging 0.71
R6638:Cep112 UTSW 11 108855870 missense probably damaging 1.00
R6916:Cep112 UTSW 11 108859376 missense probably damaging 1.00
R7182:Cep112 UTSW 11 108682844 missense probably benign 0.07
R7262:Cep112 UTSW 11 108664641 missense probably damaging 0.99
R7386:Cep112 UTSW 11 108808681 missense probably benign 0.00
R7539:Cep112 UTSW 11 108855828 missense probably benign 0.38
R8262:Cep112 UTSW 11 108503151 missense probably damaging 1.00
R8681:Cep112 UTSW 11 108425652 critical splice donor site probably null
R8845:Cep112 UTSW 11 108570367 missense probably damaging 1.00
R8955:Cep112 UTSW 11 108752434 missense possibly damaging 0.61
R9213:Cep112 UTSW 11 108486953 missense probably benign
R9348:Cep112 UTSW 11 108437250 missense probably damaging 0.97
R9516:Cep112 UTSW 11 108757688 missense probably damaging 0.99
R9771:Cep112 UTSW 11 108682691 intron probably benign
R9784:Cep112 UTSW 11 108570391 missense probably damaging 1.00
Z1176:Cep112 UTSW 11 108425310 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCTGCGAGTGGGTTAGAC -3'
(R):5'- AGCACCCTAGACAGCATAGTG -3'

Sequencing Primer
(F):5'- CTTATGATGTTCCTACCTAAGTGGG -3'
(R):5'- CCCTAGACAGCATAGTGTGTTTTGAC -3'
Posted On 2015-07-07