Incidental Mutation 'R4407:Wnk3'
ID327744
Institutional Source Beutler Lab
Gene Symbol Wnk3
Ensembl Gene ENSMUSG00000041245
Gene NameWNK lysine deficient protein kinase 3
SynonymsPrkwnk3
MMRRC Submission 041689-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R4407 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location151198078-151320152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 151233213 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 555 (P555Q)
Ref Sequence ENSEMBL: ENSMUSP00000138822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096285] [ENSMUST00000149140] [ENSMUST00000184392] [ENSMUST00000184730]
Predicted Effect probably benign
Transcript: ENSMUST00000096285
AA Change: P555Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138839
Gene: ENSMUSG00000041245
AA Change: P555Q

DomainStartEndE-ValueType
low complexity region 121 136 N/A INTRINSIC
S_TKc 146 404 4.88e-68 SMART
Pfam:OSR1_C 425 462 7.9e-23 PFAM
low complexity region 518 531 N/A INTRINSIC
internal_repeat_1 765 806 2.88e-5 PROSPERO
low complexity region 1511 1532 N/A INTRINSIC
coiled coil region 1535 1579 N/A INTRINSIC
low complexity region 1580 1600 N/A INTRINSIC
low complexity region 1656 1670 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149140
AA Change: P555Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139255
Gene: ENSMUSG00000041245
AA Change: P555Q

DomainStartEndE-ValueType
low complexity region 121 136 N/A INTRINSIC
S_TKc 146 404 4.88e-68 SMART
Pfam:OSR1_C 425 462 2.3e-23 PFAM
low complexity region 518 531 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184392
AA Change: P555Q

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000139037
Gene: ENSMUSG00000041245
AA Change: P555Q

DomainStartEndE-ValueType
low complexity region 121 136 N/A INTRINSIC
S_TKc 146 404 4.88e-68 SMART
Pfam:OSR1_C 425 462 7.8e-23 PFAM
low complexity region 518 531 N/A INTRINSIC
internal_repeat_1 733 774 2.87e-5 PROSPERO
low complexity region 1479 1500 N/A INTRINSIC
coiled coil region 1503 1547 N/A INTRINSIC
low complexity region 1548 1568 N/A INTRINSIC
low complexity region 1624 1638 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184730
AA Change: P555Q

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000138822
Gene: ENSMUSG00000041245
AA Change: P555Q

DomainStartEndE-ValueType
low complexity region 121 136 N/A INTRINSIC
S_TKc 146 404 4.88e-68 SMART
Pfam:OSR1_C 425 462 7.5e-23 PFAM
low complexity region 518 531 N/A INTRINSIC
internal_repeat_1 733 774 2.72e-5 PROSPERO
low complexity region 1432 1453 N/A INTRINSIC
coiled coil region 1456 1500 N/A INTRINSIC
low complexity region 1501 1521 N/A INTRINSIC
low complexity region 1577 1591 N/A INTRINSIC
Meta Mutation Damage Score 0.0788 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the 'with no lysine' family of serine-threonine protein kinases. These family members lack the catalytic lysine in subdomain II, and instead have a conserved lysine in subdomain I. This family member functions as a positive regulator of the transcellular Ca2+ transport pathway, and it plays a role in the increase of cell survival in a caspase-3-dependent pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lower blood pressure when fed a low-salt diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830035A12Rik T C 11: 107,532,055 noncoding transcript Het
Bbs10 A G 10: 111,299,859 T278A probably benign Het
BC053393 A G 11: 46,577,380 T94A probably damaging Het
Bcl6b A G 11: 70,226,103 L450P probably damaging Het
Braf T G 6: 39,615,720 K674Q probably damaging Het
Cep112 C T 11: 108,519,201 T481I possibly damaging Het
Cep135 T A 5: 76,624,667 M633K probably benign Het
Cpped1 T C 16: 11,805,421 Y278C probably damaging Het
Depdc5 T A 5: 32,904,534 probably null Het
Dolpp1 C T 2: 30,396,452 A128V possibly damaging Het
E2f5 T A 3: 14,603,763 D238E probably benign Het
Fat4 A T 3: 38,958,540 D2328V probably benign Het
Fbln1 T A 15: 85,231,556 probably null Het
Fkbp3 T C 12: 65,070,004 T53A probably damaging Het
Flg2 G T 3: 93,214,869 G1449C unknown Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Glyctk A T 9: 106,157,108 probably benign Het
Gm37596 C A 3: 93,692,112 V317L probably benign Het
Gm6430 T C 1: 97,025,572 noncoding transcript Het
Golga1 C A 2: 39,019,641 probably null Het
Gucy2g A T 19: 55,237,837 F216I probably benign Het
L3mbtl3 A G 10: 26,313,884 V494A unknown Het
Lama2 AATCAGACAGGAG A 10: 27,212,128 probably benign Het
Lemd3 A T 10: 120,925,430 L907Q possibly damaging Het
Lrp2 A T 2: 69,502,517 V1552D probably damaging Het
Map3k12 T C 15: 102,505,402 T45A probably damaging Het
Mycbp2 A T 14: 103,287,228 D665E probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Olfr1178 A T 2: 88,392,083 M279L probably benign Het
Pcdhac2 G T 18: 37,144,446 V160L probably benign Het
Pcnt T C 10: 76,374,870 E2473G possibly damaging Het
Pitpnm2 T A 5: 124,152,615 I3L possibly damaging Het
Prkd3 C A 17: 78,983,558 W176L probably damaging Het
Prpf39 C T 12: 65,056,266 A438V probably damaging Het
Rpgrip1 T A 14: 52,147,399 F655I probably damaging Het
Rrp12 T C 19: 41,892,551 Y147C probably damaging Het
Sec23b A T 2: 144,574,718 N429Y possibly damaging Het
Slc2a10 T A 2: 165,514,764 S115T probably damaging Het
Spg11 A C 2: 122,075,332 D1277E probably benign Het
Sspo A G 6: 48,460,520 D1279G probably damaging Het
St18 T C 1: 6,827,837 I621T probably benign Het
Tbc1d31 T A 15: 57,920,042 D112E possibly damaging Het
Tgm4 A T 9: 123,056,530 D379V probably damaging Het
Thyn1 A T 9: 27,003,597 D15V possibly damaging Het
Tm4sf19 T C 16: 32,407,894 V167A possibly damaging Het
Trim38 A C 13: 23,791,491 Q471P probably benign Het
Trmt1 T A 8: 84,697,755 probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Usp9y T C Y: 1,336,375 I1500V probably benign Het
Vgll4 C T 6: 114,890,612 probably null Het
Vmn1r173 T A 7: 23,703,016 N225K probably damaging Het
Vmn2r22 C T 6: 123,637,954 G226R probably damaging Het
Yes1 T G 5: 32,640,585 Y83D possibly damaging Het
Zdhhc15 G A X: 104,560,688 R322* probably null Het
Other mutations in Wnk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Wnk3 APN X 151233029 missense probably damaging 1.00
IGL03033:Wnk3 APN X 151276928 missense probably damaging 1.00
R3436:Wnk3 UTSW X 151286304 missense probably benign 0.16
R4789:Wnk3 UTSW X 151210937 nonsense probably null
U24488:Wnk3 UTSW X 151209460 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGATGCTTGGAGGAACG -3'
(R):5'- AGGAAACTATCTGGTCTATTTCAAATG -3'

Sequencing Primer
(F):5'- AGGAACGCAGGGATTCCC -3'
(R):5'- TCCAATAGCTGACTGTGAGC -3'
Posted On2015-07-07