Incidental Mutation 'R4408:Gm10799'
ID327750
Institutional Source Beutler Lab
Gene Symbol Gm10799
Ensembl Gene ENSMUSG00000075006
Gene Namepredicted gene 10799
Synonyms
MMRRC Submission 041690-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R4408 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location104068047-104068550 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 104068064 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 99 (A99S)
Ref Sequence ENSEMBL: ENSMUSP00000097259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028603] [ENSMUST00000090429] [ENSMUST00000099666] [ENSMUST00000104891] [ENSMUST00000111130] [ENSMUST00000111131] [ENSMUST00000111132] [ENSMUST00000129749]
Predicted Effect probably benign
Transcript: ENSMUST00000028603
SMART Domains Protein: ENSMUSP00000028603
Gene: ENSMUSG00000027180

DomainStartEndE-ValueType
FBOX 16 56 2.83e-4 SMART
SMI1_KNR4 121 251 3.02e-5 SMART
Pfam:DUF525 294 384 3.1e-30 PFAM
coiled coil region 417 446 N/A INTRINSIC
low complexity region 462 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090429
SMART Domains Protein: ENSMUSP00000087912
Gene: ENSMUSG00000068686

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LU 24 104 1.88e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000099666
AA Change: A99S

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097259
Gene: ENSMUSG00000075006
AA Change: A99S

DomainStartEndE-ValueType
low complexity region 86 99 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000104891
SMART Domains Protein: ENSMUSP00000100487
Gene: ENSMUSG00000078091

DomainStartEndE-ValueType
low complexity region 87 100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111130
SMART Domains Protein: ENSMUSP00000106760
Gene: ENSMUSG00000068686

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LU 24 104 1.88e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111131
SMART Domains Protein: ENSMUSP00000106761
Gene: ENSMUSG00000068686

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UPAR_LY6 26 84 1.1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111132
SMART Domains Protein: ENSMUSP00000106762
Gene: ENSMUSG00000068686

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UPAR_LY6 26 55 1.2e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129749
SMART Domains Protein: ENSMUSP00000117553
Gene: ENSMUSG00000068686

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LU 24 104 1.88e-19 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1h A G 17: 25,380,627 V1588A probably damaging Het
Card6 T A 15: 5,101,054 M287L probably damaging Het
Fam227b T A 2: 126,116,125 Y240F possibly damaging Het
Fbln1 T A 15: 85,231,556 probably null Het
Fndc5 A G 4: 129,142,529 probably null Het
Gm27013 A T 6: 130,677,765 S245T possibly damaging Het
Gm5592 A G 7: 41,286,448 T125A probably benign Het
Gml2 T C 15: 74,824,339 probably benign Het
Gpbp1 A T 13: 111,448,964 N149K possibly damaging Het
Gprc6a T C 10: 51,628,543 I68M probably benign Het
Hnrnpu T C 1: 178,330,803 probably benign Het
Irf5 A G 6: 29,534,001 probably null Het
Lrp2 T A 2: 69,467,169 K3149N probably benign Het
Lrrn3 A G 12: 41,454,042 V92A probably benign Het
Map3k12 T C 15: 102,505,402 T45A probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Olfr1283 T A 2: 111,369,280 I216K possibly damaging Het
Olfr466 A G 13: 65,152,700 T159A probably benign Het
Osr2 T C 15: 35,300,471 Y58H possibly damaging Het
Pop5 C T 5: 115,240,777 probably benign Het
Ror2 A G 13: 53,118,961 C211R probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sgsm2 C A 11: 74,851,766 R957L probably damaging Het
Slc16a11 A G 11: 70,215,734 probably null Het
Spag17 T A 3: 100,103,378 Y2063N probably benign Het
Usp25 A C 16: 77,115,453 K1020T probably damaging Het
Vmn1r23 T C 6: 57,926,368 I142V probably benign Het
Vmn1r235 A G 17: 21,261,592 K60E probably damaging Het
Vmn2r33 A C 7: 7,551,230 F775V probably damaging Het
Vps13b C T 15: 35,709,294 P1796S probably damaging Het
Vwa3a G A 7: 120,778,926 V480I probably benign Het
Other mutations in Gm10799
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4884:Gm10799 UTSW 2 104068207 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTGAGAAGGTTTTCAGCCAC -3'
(R):5'- TCACCACATGGCAATACCTG -3'

Sequencing Primer
(F):5'- GGTTTTCAGCCACAAGGAGACC -3'
(R):5'- GTCAAGAAGAAGCCCCCTGTTTG -3'
Posted On2015-07-07