Incidental Mutation 'R4408:Olfr1283'
ID327751
Institutional Source Beutler Lab
Gene Symbol Olfr1283
Ensembl Gene ENSMUSG00000109322
Gene Nameolfactory receptor 1283
SynonymsGA_x6K02T2Q125-72420217-72421134, MOR248-19
MMRRC Submission 041690-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.391) question?
Stock #R4408 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111366790-111370063 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111369280 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 216 (I216K)
Ref Sequence ENSEMBL: ENSMUSP00000150510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082167] [ENSMUST00000090328] [ENSMUST00000204064] [ENSMUST00000216637]
Predicted Effect possibly damaging
Transcript: ENSMUST00000082167
AA Change: I216K

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000080805
Gene: ENSMUSG00000109449
AA Change: I216K

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 3.8e-50 PFAM
Pfam:7tm_1 41 287 9.9e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000090328
AA Change: I216K

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000087800
Gene: ENSMUSG00000109322
AA Change: I216K

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 3.6e-49 PFAM
Pfam:7tm_1 41 287 3.9e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204064
AA Change: I216K

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000145495
Gene: ENSMUSG00000109322
AA Change: I216K

DomainStartEndE-ValueType
Pfam:7tm_4 30 298 2.1e-39 PFAM
Pfam:7tm_1 40 286 7.8e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216637
AA Change: I216K

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1h A G 17: 25,380,627 V1588A probably damaging Het
Card6 T A 15: 5,101,054 M287L probably damaging Het
Fam227b T A 2: 126,116,125 Y240F possibly damaging Het
Fbln1 T A 15: 85,231,556 probably null Het
Fndc5 A G 4: 129,142,529 probably null Het
Gm10799 C A 2: 104,068,064 A99S possibly damaging Het
Gm27013 A T 6: 130,677,765 S245T possibly damaging Het
Gm5592 A G 7: 41,286,448 T125A probably benign Het
Gml2 T C 15: 74,824,339 probably benign Het
Gpbp1 A T 13: 111,448,964 N149K possibly damaging Het
Gprc6a T C 10: 51,628,543 I68M probably benign Het
Hnrnpu T C 1: 178,330,803 probably benign Het
Irf5 A G 6: 29,534,001 probably null Het
Lrp2 T A 2: 69,467,169 K3149N probably benign Het
Lrrn3 A G 12: 41,454,042 V92A probably benign Het
Map3k12 T C 15: 102,505,402 T45A probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Olfr466 A G 13: 65,152,700 T159A probably benign Het
Osr2 T C 15: 35,300,471 Y58H possibly damaging Het
Pop5 C T 5: 115,240,777 probably benign Het
Ror2 A G 13: 53,118,961 C211R probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sgsm2 C A 11: 74,851,766 R957L probably damaging Het
Slc16a11 A G 11: 70,215,734 probably null Het
Spag17 T A 3: 100,103,378 Y2063N probably benign Het
Usp25 A C 16: 77,115,453 K1020T probably damaging Het
Vmn1r23 T C 6: 57,926,368 I142V probably benign Het
Vmn1r235 A G 17: 21,261,592 K60E probably damaging Het
Vmn2r33 A C 7: 7,551,230 F775V probably damaging Het
Vps13b C T 15: 35,709,294 P1796S probably damaging Het
Vwa3a G A 7: 120,778,926 V480I probably benign Het
Other mutations in Olfr1283
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02337:Olfr1283 APN 2 111369151 missense probably benign 0.22
IGL02716:Olfr1283 APN 2 111368781 missense probably benign 0.04
R0090:Olfr1283 UTSW 2 111369294 missense probably damaging 1.00
R0141:Olfr1283 UTSW 2 111369490 missense probably damaging 1.00
R0371:Olfr1283 UTSW 2 111369153 missense probably benign 0.00
R0417:Olfr1283 UTSW 2 111369105 missense possibly damaging 0.57
R1673:Olfr1283 UTSW 2 111369207 missense probably benign 0.11
R1970:Olfr1283 UTSW 2 111369076 missense probably benign 0.19
R2069:Olfr1283 UTSW 2 111369095 missense probably benign 0.43
R3897:Olfr1283 UTSW 2 111368761 missense possibly damaging 0.87
R5397:Olfr1283 UTSW 2 111368940 missense probably benign 0.00
R5888:Olfr1283 UTSW 2 111368743 missense probably benign
R6281:Olfr1283 UTSW 2 111369549 makesense probably null
R6323:Olfr1283 UTSW 2 111368701 missense possibly damaging 0.94
R6801:Olfr1283 UTSW 2 111369049 missense probably benign 0.22
R7219:Olfr1283 UTSW 2 111369537 missense probably benign
R7271:Olfr1283 UTSW 2 111369348 missense probably damaging 1.00
R7438:Olfr1283 UTSW 2 111369362 missense probably damaging 1.00
R7761:Olfr1283 UTSW 2 111368793 missense probably benign 0.00
R7792:Olfr1283 UTSW 2 111369403 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTGATCTCGTGGACCATTGG -3'
(R):5'- TGTGATGACTGAGTAAAACACAGC -3'

Sequencing Primer
(F):5'- GGACCATTGGCTTTATACATGC -3'
(R):5'- CAAGAAACTTGTCAACCCAGGTGATG -3'
Posted On2015-07-07