Mutagenetix > Incidental Mutations

Incidental Mutation 'R4408:Olfr1283'

327751

Institutional Source

Beutler Lab

Gene Symbol

Olfr1283

Ensembl Gene

ENSMUSG00000109322

Gene Name

olfactory receptor 1283

Synonyms

GA_x6K02T2Q125-72420217-72421134, MOR248-19

MMRRC Submission

041690-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.550) question?

Stock #

R4408 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

111366790-111370063 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 111369280 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 216 (I216K)

Ref Sequence

ENSEMBL: ENSMUSP00000150510 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082167] [ENSMUST00000090328] [ENSMUST00000204064] [ENSMUST00000216637]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000082167
AA Change: I216K

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000080805
Gene: ENSMUSG00000109449
AA Change: I216K

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	305	3.8e-50	PFAM
Pfam:7tm_1	41	287	9.9e-21	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000090328
AA Change: I216K

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000087800
Gene: ENSMUSG00000109322
AA Change: I216K

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	304	3.6e-49	PFAM
Pfam:7tm_1	41	287	3.9e-20	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000204064
AA Change: I216K

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000145495
Gene: ENSMUSG00000109322
AA Change: I216K

Domain	Start	End	E-Value	Type
Pfam:7tm_4	30	298	2.1e-39	PFAM
Pfam:7tm_1	40	286	7.8e-15	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000216637
AA Change: I216K

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.6%

Validation Efficiency

97% (35/36)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cacna1h	A	G	17: 25,380,627	V1588A	probably damaging	Het
Card6	T	A	15: 5,101,054	M287L	probably damaging	Het
Fam227b	T	A	2: 126,116,125	Y240F	possibly damaging	Het
Fbln1	T	A	15: 85,231,556		probably null	Het
Fndc5	A	G	4: 129,142,529		probably null	Het
Gm10799	C	A	2: 104,068,064	A99S	possibly damaging	Het
Gm27013	A	T	6: 130,677,765	S245T	possibly damaging	Het
Gm5592	A	G	7: 41,286,448	T125A	probably benign	Het
Gml2	T	C	15: 74,824,339		probably benign	Het
Gpbp1	A	T	13: 111,448,964	N149K	possibly damaging	Het
Gprc6a	T	C	10: 51,628,543	I68M	probably benign	Het
Hnrnpu	T	C	1: 178,330,803		probably benign	Het
Irf5	A	G	6: 29,534,001		probably null	Het
Lrp2	T	A	2: 69,467,169	K3149N	probably benign	Het
Lrrn3	A	G	12: 41,454,042	V92A	probably benign	Het
Map3k12	T	C	15: 102,505,402	T45A	probably damaging	Het
Myof	A	G	19: 37,922,978	S1502P	probably damaging	Het
Olfr466	A	G	13: 65,152,700	T159A	probably benign	Het
Osr2	T	C	15: 35,300,471	Y58H	possibly damaging	Het
Pop5	C	T	5: 115,240,777		probably benign	Het
Ror2	A	G	13: 53,118,961	C211R	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sgsm2	C	A	11: 74,851,766	R957L	probably damaging	Het
Slc16a11	A	G	11: 70,215,734		probably null	Het
Spag17	T	A	3: 100,103,378	Y2063N	probably benign	Het
Usp25	A	C	16: 77,115,453	K1020T	probably damaging	Het
Vmn1r23	T	C	6: 57,926,368	I142V	probably benign	Het
Vmn1r235	A	G	17: 21,261,592	K60E	probably damaging	Het
Vmn2r33	A	C	7: 7,551,230	F775V	probably damaging	Het
Vps13b	C	T	15: 35,709,294	P1796S	probably damaging	Het
Vwa3a	G	A	7: 120,778,926	V480I	probably benign	Het

Other mutations in Olfr1283

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02337:Olfr1283	APN	2	111369151	missense	probably benign	0.22
IGL02716:Olfr1283	APN	2	111368781	missense	probably benign	0.04
R0090:Olfr1283	UTSW	2	111369294	missense	probably damaging	1.00
R0141:Olfr1283	UTSW	2	111369490	missense	probably damaging	1.00
R0371:Olfr1283	UTSW	2	111369153	missense	probably benign	0.00
R0417:Olfr1283	UTSW	2	111369105	missense	possibly damaging	0.57
R1673:Olfr1283	UTSW	2	111369207	missense	probably benign	0.11
R1970:Olfr1283	UTSW	2	111369076	missense	probably benign	0.19
R2069:Olfr1283	UTSW	2	111369095	missense	probably benign	0.43
R3897:Olfr1283	UTSW	2	111368761	missense	possibly damaging	0.87
R5397:Olfr1283	UTSW	2	111368940	missense	probably benign	0.00
R5888:Olfr1283	UTSW	2	111368743	missense	probably benign
R6281:Olfr1283	UTSW	2	111369549	makesense	probably null
R6323:Olfr1283	UTSW	2	111368701	missense	possibly damaging	0.94
R6801:Olfr1283	UTSW	2	111369049	missense	probably benign	0.22
R7219:Olfr1283	UTSW	2	111369537	missense	probably benign
R7271:Olfr1283	UTSW	2	111369348	missense	probably damaging	1.00
R7438:Olfr1283	UTSW	2	111369362	missense	probably damaging	1.00
R7761:Olfr1283	UTSW	2	111368793	missense	probably benign	0.00
R7792:Olfr1283	UTSW	2	111369403	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GTGATCTCGTGGACCATTGG -3'
(R):5'- TGTGATGACTGAGTAAAACACAGC -3'

Sequencing Primer
(F):5'- GGACCATTGGCTTTATACATGC -3'
(R):5'- CAAGAAACTTGTCAACCCAGGTGATG -3'

Posted On

2015-07-07