Incidental Mutation 'R4408:Pop5'
List |< first << previous [record 21 of 32] next >> last >|
ID327756
Institutional Source Beutler Lab
Gene Symbol Pop5
Ensembl Gene ENSMUSG00000060152
Gene Nameprocessing of precursor 5, ribonuclease P/MRP family (S. cerevisiae)
Synonyms2700077E03Rik, 1500019J17Rik, Rnasep3
MMRRC Submission 041690-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R4408 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location115235836-115245351 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 115240777 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000040555] [ENSMUST00000081497] [ENSMUST00000112096] [ENSMUST00000112097] [ENSMUST00000135455]
Predicted Effect probably benign
Transcript: ENSMUST00000040555
SMART Domains Protein: ENSMUSP00000041778
Gene: ENSMUSG00000041740

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 18 31 N/A INTRINSIC
low complexity region 78 90 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
RING 225 266 1.98e-8 SMART
low complexity region 379 400 N/A INTRINSIC
low complexity region 439 461 N/A INTRINSIC
low complexity region 591 618 N/A INTRINSIC
low complexity region 660 671 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081497
SMART Domains Protein: ENSMUSP00000080215
Gene: ENSMUSG00000060152

DomainStartEndE-ValueType
Pfam:RNase_P_Rpp14 7 115 2.8e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112096
SMART Domains Protein: ENSMUSP00000107725
Gene: ENSMUSG00000041740

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 18 31 N/A INTRINSIC
low complexity region 78 90 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
RING 225 266 1.98e-8 SMART
low complexity region 379 400 N/A INTRINSIC
low complexity region 439 461 N/A INTRINSIC
low complexity region 591 618 N/A INTRINSIC
low complexity region 660 671 N/A INTRINSIC
low complexity region 782 793 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112097
SMART Domains Protein: ENSMUSP00000107726
Gene: ENSMUSG00000041740

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 18 31 N/A INTRINSIC
low complexity region 78 90 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
RING 225 266 1.98e-8 SMART
low complexity region 379 400 N/A INTRINSIC
low complexity region 440 462 N/A INTRINSIC
low complexity region 592 619 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128830
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128954
Predicted Effect probably benign
Transcript: ENSMUST00000135455
SMART Domains Protein: ENSMUSP00000118408
Gene: ENSMUSG00000060152

DomainStartEndE-ValueType
Pfam:RNase_P_Rpp14 7 117 3.7e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139853
SMART Domains Protein: ENSMUSP00000131696
Gene: ENSMUSG00000041740

DomainStartEndE-ValueType
low complexity region 41 53 N/A INTRINSIC
low complexity region 63 77 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
RING 188 229 1.98e-8 SMART
low complexity region 342 363 N/A INTRINSIC
low complexity region 402 424 N/A INTRINSIC
low complexity region 554 581 N/A INTRINSIC
low complexity region 623 634 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142233
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153553
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154800
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1h A G 17: 25,380,627 V1588A probably damaging Het
Card6 T A 15: 5,101,054 M287L probably damaging Het
Fam227b T A 2: 126,116,125 Y240F possibly damaging Het
Fbln1 T A 15: 85,231,556 probably null Het
Fndc5 A G 4: 129,142,529 probably null Het
Gm10799 C A 2: 104,068,064 A99S possibly damaging Het
Gm27013 A T 6: 130,677,765 S245T possibly damaging Het
Gm5592 A G 7: 41,286,448 T125A probably benign Het
Gml2 T C 15: 74,824,339 probably benign Het
Gpbp1 A T 13: 111,448,964 N149K possibly damaging Het
Gprc6a T C 10: 51,628,543 I68M probably benign Het
Hnrnpu T C 1: 178,330,803 probably benign Het
Irf5 A G 6: 29,534,001 probably null Het
Lrp2 T A 2: 69,467,169 K3149N probably benign Het
Lrrn3 A G 12: 41,454,042 V92A probably benign Het
Map3k12 T C 15: 102,505,402 T45A probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Olfr1283 T A 2: 111,369,280 I216K possibly damaging Het
Olfr466 A G 13: 65,152,700 T159A probably benign Het
Osr2 T C 15: 35,300,471 Y58H possibly damaging Het
Ror2 A G 13: 53,118,961 C211R probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sgsm2 C A 11: 74,851,766 R957L probably damaging Het
Slc16a11 A G 11: 70,215,734 probably null Het
Spag17 T A 3: 100,103,378 Y2063N probably benign Het
Usp25 A C 16: 77,115,453 K1020T probably damaging Het
Vmn1r23 T C 6: 57,926,368 I142V probably benign Het
Vmn1r235 A G 17: 21,261,592 K60E probably damaging Het
Vmn2r33 A C 7: 7,551,230 F775V probably damaging Het
Vps13b C T 15: 35,709,294 P1796S probably damaging Het
Vwa3a G A 7: 120,778,926 V480I probably benign Het
Other mutations in Pop5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Pop5 APN 5 115240559 unclassified probably benign
R0127:Pop5 UTSW 5 115240171 missense probably damaging 1.00
R2045:Pop5 UTSW 5 115238212 missense possibly damaging 0.94
R3744:Pop5 UTSW 5 115240508 missense possibly damaging 0.80
R5458:Pop5 UTSW 5 115240437 unclassified probably benign
R5607:Pop5 UTSW 5 115240201 missense probably damaging 0.97
R7169:Pop5 UTSW 5 115240228 missense possibly damaging 0.88
R7608:Pop5 UTSW 5 115237872 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGCACTGACGAAGGTAAGC -3'
(R):5'- ACCCCTGAGCTAAGCAGTTAC -3'

Sequencing Primer
(F):5'- CAATGCCAGGCCAGCGTAAG -3'
(R):5'- TGAGCTAAGCAGTTACATCCG -3'
Posted On2015-07-07