Incidental Mutation 'R4408:Irf5'
ID327757
Institutional Source Beutler Lab
Gene Symbol Irf5
Ensembl Gene ENSMUSG00000029771
Gene Nameinterferon regulatory factor 5
Synonymsmirf5
MMRRC Submission 041690-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4408 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location29526625-29541871 bp(+) (GRCm38)
Type of Mutationunclassified (4 bp from exon)
DNA Base Change (assembly) A to G at 29534001 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004392] [ENSMUST00000163511] [ENSMUST00000164626] [ENSMUST00000164922] [ENSMUST00000167252]
Predicted Effect probably damaging
Transcript: ENSMUST00000004392
AA Change: D82G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004392
Gene: ENSMUSG00000029771
AA Change: D82G

DomainStartEndE-ValueType
IRF 10 123 6.39e-63 SMART
low complexity region 181 203 N/A INTRINSIC
IRF-3 246 430 1.67e-89 SMART
low complexity region 465 478 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163511
AA Change: D82G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127021
Gene: ENSMUSG00000029771
AA Change: D82G

DomainStartEndE-ValueType
IRF 10 123 6.39e-63 SMART
low complexity region 181 203 N/A INTRINSIC
IRF-3 246 430 1.67e-89 SMART
low complexity region 465 478 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164626
SMART Domains Protein: ENSMUSP00000130548
Gene: ENSMUSG00000029771

DomainStartEndE-ValueType
IRF 10 80 9.78e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164922
AA Change: D45G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145299
Gene: ENSMUSG00000029771
AA Change: D45G

DomainStartEndE-ValueType
IRF 1 86 7.7e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167252
AA Change: D82G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126273
Gene: ENSMUSG00000029771
AA Change: D82G

DomainStartEndE-ValueType
IRF 10 123 2.8e-65 SMART
low complexity region 181 203 N/A INTRINSIC
IRF-3 246 430 1.3e-93 SMART
Meta Mutation Damage Score 0.9284 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the interferon regulatory factor (IRF) family, a group of transcription factors with diverse roles, including virus-mediated activation of interferon, and modulation of cell growth, differentiation, apoptosis, and immune system activity. Members of the IRF family are characterized by a conserved N-terminal DNA-binding domain containing tryptophan (W) repeats. Alternative promoter use and alternative splicing result in multiple transcript variants, and a 30-nt indel polymorphism (SNP rs60344245) can result in loss of a 10-aa segment. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null mice exhibit resistance to lethal shock with a marked decrease in the serum levels of proinflammatory cytokines, but normal B cell development. Mice homozygous for another allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1h A G 17: 25,380,627 V1588A probably damaging Het
Card6 T A 15: 5,101,054 M287L probably damaging Het
Fam227b T A 2: 126,116,125 Y240F possibly damaging Het
Fbln1 T A 15: 85,231,556 probably null Het
Fndc5 A G 4: 129,142,529 probably null Het
Gm10799 C A 2: 104,068,064 A99S possibly damaging Het
Gm27013 A T 6: 130,677,765 S245T possibly damaging Het
Gm5592 A G 7: 41,286,448 T125A probably benign Het
Gml2 T C 15: 74,824,339 probably benign Het
Gpbp1 A T 13: 111,448,964 N149K possibly damaging Het
Gprc6a T C 10: 51,628,543 I68M probably benign Het
Hnrnpu T C 1: 178,330,803 probably benign Het
Lrp2 T A 2: 69,467,169 K3149N probably benign Het
Lrrn3 A G 12: 41,454,042 V92A probably benign Het
Map3k12 T C 15: 102,505,402 T45A probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Olfr1283 T A 2: 111,369,280 I216K possibly damaging Het
Olfr466 A G 13: 65,152,700 T159A probably benign Het
Osr2 T C 15: 35,300,471 Y58H possibly damaging Het
Pop5 C T 5: 115,240,777 probably benign Het
Ror2 A G 13: 53,118,961 C211R probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sgsm2 C A 11: 74,851,766 R957L probably damaging Het
Slc16a11 A G 11: 70,215,734 probably null Het
Spag17 T A 3: 100,103,378 Y2063N probably benign Het
Usp25 A C 16: 77,115,453 K1020T probably damaging Het
Vmn1r23 T C 6: 57,926,368 I142V probably benign Het
Vmn1r235 A G 17: 21,261,592 K60E probably damaging Het
Vmn2r33 A C 7: 7,551,230 F775V probably damaging Het
Vps13b C T 15: 35,709,294 P1796S probably damaging Het
Vwa3a G A 7: 120,778,926 V480I probably benign Het
Other mutations in Irf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01131:Irf5 APN 6 29536103 missense probably damaging 1.00
IGL02405:Irf5 APN 6 29535761 missense probably damaging 0.99
IGL02953:Irf5 APN 6 29536672 missense possibly damaging 0.76
R0099:Irf5 UTSW 6 29533967 missense probably damaging 0.98
R0116:Irf5 UTSW 6 29536109 missense probably damaging 1.00
R0482:Irf5 UTSW 6 29535370 missense probably benign 0.00
R1827:Irf5 UTSW 6 29536673 missense possibly damaging 0.67
R1938:Irf5 UTSW 6 29536739 missense probably benign 0.05
R3969:Irf5 UTSW 6 29536782 missense probably benign 0.00
R4447:Irf5 UTSW 6 29535942 missense probably damaging 1.00
R4828:Irf5 UTSW 6 29531141 missense probably damaging 0.99
R5555:Irf5 UTSW 6 29531146 missense probably benign 0.00
R5891:Irf5 UTSW 6 29529425 intron probably benign
R6148:Irf5 UTSW 6 29535959 missense probably damaging 1.00
R7084:Irf5 UTSW 6 29535877 missense probably damaging 0.98
R7274:Irf5 UTSW 6 29534040 missense probably damaging 1.00
R7832:Irf5 UTSW 6 29535462 missense probably benign
R7915:Irf5 UTSW 6 29535462 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGGTTGGACAAGATCTGGTC -3'
(R):5'- CCAGAGTTCATAGCTTTCAGGTG -3'

Sequencing Primer
(F):5'- CACCTAATGAGCCTGTCTGG -3'
(R):5'- ATAGCTTTCAGGTGGTCACAC -3'
Posted On2015-07-07