Incidental Mutation 'R4408:Vmn1r23'
ID327758
Institutional Source Beutler Lab
Gene Symbol Vmn1r23
Ensembl Gene ENSMUSG00000093376
Gene Namevomeronasal 1 receptor 23
SynonymsV1rc24
MMRRC Submission 041690-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R4408 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location57925842-57926838 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57926368 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 142 (I142V)
Ref Sequence ENSEMBL: ENSMUSP00000135676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000175817]
Predicted Effect probably benign
Transcript: ENSMUST00000175817
AA Change: I142V

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000135676
Gene: ENSMUSG00000093376
AA Change: I142V

DomainStartEndE-ValueType
Pfam:V1R 28 293 3.1e-57 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1h A G 17: 25,380,627 V1588A probably damaging Het
Card6 T A 15: 5,101,054 M287L probably damaging Het
Fam227b T A 2: 126,116,125 Y240F possibly damaging Het
Fbln1 T A 15: 85,231,556 probably null Het
Fndc5 A G 4: 129,142,529 probably null Het
Gm10799 C A 2: 104,068,064 A99S possibly damaging Het
Gm27013 A T 6: 130,677,765 S245T possibly damaging Het
Gm5592 A G 7: 41,286,448 T125A probably benign Het
Gml2 T C 15: 74,824,339 probably benign Het
Gpbp1 A T 13: 111,448,964 N149K possibly damaging Het
Gprc6a T C 10: 51,628,543 I68M probably benign Het
Hnrnpu T C 1: 178,330,803 probably benign Het
Irf5 A G 6: 29,534,001 probably null Het
Lrp2 T A 2: 69,467,169 K3149N probably benign Het
Lrrn3 A G 12: 41,454,042 V92A probably benign Het
Map3k12 T C 15: 102,505,402 T45A probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Olfr1283 T A 2: 111,369,280 I216K possibly damaging Het
Olfr466 A G 13: 65,152,700 T159A probably benign Het
Osr2 T C 15: 35,300,471 Y58H possibly damaging Het
Pop5 C T 5: 115,240,777 probably benign Het
Ror2 A G 13: 53,118,961 C211R probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sgsm2 C A 11: 74,851,766 R957L probably damaging Het
Slc16a11 A G 11: 70,215,734 probably null Het
Spag17 T A 3: 100,103,378 Y2063N probably benign Het
Usp25 A C 16: 77,115,453 K1020T probably damaging Het
Vmn1r235 A G 17: 21,261,592 K60E probably damaging Het
Vmn2r33 A C 7: 7,551,230 F775V probably damaging Het
Vps13b C T 15: 35,709,294 P1796S probably damaging Het
Vwa3a G A 7: 120,778,926 V480I probably benign Het
Other mutations in Vmn1r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01563:Vmn1r23 APN 6 57926076 missense possibly damaging 0.89
IGL01980:Vmn1r23 APN 6 57926490 missense probably damaging 1.00
IGL02934:Vmn1r23 APN 6 57925929 missense probably benign 0.26
IGL03153:Vmn1r23 APN 6 57925932 missense probably damaging 0.98
R0410:Vmn1r23 UTSW 6 57926190 missense probably benign 0.11
R0452:Vmn1r23 UTSW 6 57926484 missense possibly damaging 0.90
R0590:Vmn1r23 UTSW 6 57926364 missense probably benign 0.43
R0647:Vmn1r23 UTSW 6 57926184 missense probably benign
R0692:Vmn1r23 UTSW 6 57926125 nonsense probably null
R1674:Vmn1r23 UTSW 6 57926061 missense possibly damaging 0.75
R1744:Vmn1r23 UTSW 6 57925925 missense possibly damaging 0.81
R1774:Vmn1r23 UTSW 6 57926690 missense probably damaging 0.97
R2101:Vmn1r23 UTSW 6 57926452 missense possibly damaging 0.90
R2202:Vmn1r23 UTSW 6 57926619 missense probably benign 0.01
R2204:Vmn1r23 UTSW 6 57926619 missense probably benign 0.01
R2205:Vmn1r23 UTSW 6 57926619 missense probably benign 0.01
R4282:Vmn1r23 UTSW 6 57926467 missense probably benign 0.27
R4532:Vmn1r23 UTSW 6 57925929 missense probably benign 0.21
R4690:Vmn1r23 UTSW 6 57926025 missense probably benign
R4700:Vmn1r23 UTSW 6 57926205 missense probably benign 0.17
R4894:Vmn1r23 UTSW 6 57926325 missense probably benign 0.00
R6164:Vmn1r23 UTSW 6 57926055 missense possibly damaging 0.90
R6930:Vmn1r23 UTSW 6 57926145 missense probably benign
R7129:Vmn1r23 UTSW 6 57926076 missense possibly damaging 0.89
R7731:Vmn1r23 UTSW 6 57926334 missense probably benign 0.03
R7877:Vmn1r23 UTSW 6 57926556 missense probably benign
R7960:Vmn1r23 UTSW 6 57926556 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGGTGCCTGATGCTATGAAG -3'
(R):5'- CACTAGTAGGGTGATGAGAGGACTC -3'

Sequencing Primer
(F):5'- CCTGATGCTATGAAGATGCTTGC -3'
(R):5'- AGGACTCTCTATGGGCATCACATG -3'
Posted On2015-07-07