Incidental Mutation 'R4408:Vmn2r33'
ID327760
Institutional Source Beutler Lab
Gene Symbol Vmn2r33
Ensembl Gene ENSMUSG00000096691
Gene Namevomeronasal 2, receptor 33
Synonyms
MMRRC Submission 041690-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R4408 (G1)
Quality Score173
Status Not validated
Chromosome7
Chromosomal Location7550967-7566786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 7551230 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 775 (F775V)
Ref Sequence ENSEMBL: ENSMUSP00000129960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165921]
Predicted Effect probably damaging
Transcript: ENSMUST00000165921
AA Change: F775V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129960
Gene: ENSMUSG00000096691
AA Change: F775V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 4.2e-34 PFAM
Pfam:NCD3G 512 565 4.1e-19 PFAM
Pfam:7tm_3 598 833 3.1e-55 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1h A G 17: 25,380,627 V1588A probably damaging Het
Card6 T A 15: 5,101,054 M287L probably damaging Het
Fam227b T A 2: 126,116,125 Y240F possibly damaging Het
Fbln1 T A 15: 85,231,556 probably null Het
Fndc5 A G 4: 129,142,529 probably null Het
Gm10799 C A 2: 104,068,064 A99S possibly damaging Het
Gm27013 A T 6: 130,677,765 S245T possibly damaging Het
Gm5592 A G 7: 41,286,448 T125A probably benign Het
Gml2 T C 15: 74,824,339 probably benign Het
Gpbp1 A T 13: 111,448,964 N149K possibly damaging Het
Gprc6a T C 10: 51,628,543 I68M probably benign Het
Hnrnpu T C 1: 178,330,803 probably benign Het
Irf5 A G 6: 29,534,001 probably null Het
Lrp2 T A 2: 69,467,169 K3149N probably benign Het
Lrrn3 A G 12: 41,454,042 V92A probably benign Het
Map3k12 T C 15: 102,505,402 T45A probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Olfr1283 T A 2: 111,369,280 I216K possibly damaging Het
Olfr466 A G 13: 65,152,700 T159A probably benign Het
Osr2 T C 15: 35,300,471 Y58H possibly damaging Het
Pop5 C T 5: 115,240,777 probably benign Het
Ror2 A G 13: 53,118,961 C211R probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sgsm2 C A 11: 74,851,766 R957L probably damaging Het
Slc16a11 A G 11: 70,215,734 probably null Het
Spag17 T A 3: 100,103,378 Y2063N probably benign Het
Usp25 A C 16: 77,115,453 K1020T probably damaging Het
Vmn1r23 T C 6: 57,926,368 I142V probably benign Het
Vmn1r235 A G 17: 21,261,592 K60E probably damaging Het
Vps13b C T 15: 35,709,294 P1796S probably damaging Het
Vwa3a G A 7: 120,778,926 V480I probably benign Het
Other mutations in Vmn2r33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01893:Vmn2r33 APN 7 7563777 missense probably benign
R1147:Vmn2r33 UTSW 7 7554145 missense probably benign 0.16
R1147:Vmn2r33 UTSW 7 7554145 missense probably benign 0.16
R3966:Vmn2r33 UTSW 7 7554169 missense probably benign 0.00
R6571:Vmn2r33 UTSW 7 7563669 missense probably benign 0.00
R6783:Vmn2r33 UTSW 7 7563798 missense probably benign
R7180:Vmn2r33 UTSW 7 7563897 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAACTTTACATTGGACACAATTCC -3'
(R):5'- GGCTAGAAGTTTCTCCTCCC -3'

Sequencing Primer
(F):5'- GGACACAATTCCTGAATTATTCGTTC -3'
(R):5'- CTCCCTTTGTTGATATTGATGAACAC -3'
Posted On2015-07-07