Incidental Mutation 'R4408:Slc16a11'
ID327765
Institutional Source Beutler Lab
Gene Symbol Slc16a11
Ensembl Gene ENSMUSG00000040938
Gene Namesolute carrier family 16 (monocarboxylic acid transporters), member 11
SynonymsMNCb-2717
MMRRC Submission 041690-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4408 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location70212752-70216417 bp(+) (GRCm38)
Type of Mutationunclassified (747 bp from exon)
DNA Base Change (assembly) A to G at 70215734 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060010] [ENSMUST00000094055] [ENSMUST00000123716] [ENSMUST00000126296] [ENSMUST00000126388] [ENSMUST00000136328] [ENSMUST00000141290] [ENSMUST00000153993] [ENSMUST00000159867] [ENSMUST00000171032] [ENSMUST00000190533]
Predicted Effect probably benign
Transcript: ENSMUST00000060010
SMART Domains Protein: ENSMUSP00000053218
Gene: ENSMUSG00000044367

DomainStartEndE-ValueType
Pfam:MFS_1 14 277 1.7e-22 PFAM
Pfam:MFS_1 219 423 6.8e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094055
AA Change: D266G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091597
Gene: ENSMUSG00000040938
AA Change: D266G

DomainStartEndE-ValueType
Pfam:MFS_1 17 340 5.5e-24 PFAM
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 380 402 N/A INTRINSIC
low complexity region 407 420 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122852
Predicted Effect probably benign
Transcript: ENSMUST00000123716
SMART Domains Protein: ENSMUSP00000114871
Gene: ENSMUSG00000040938

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000126296
SMART Domains Protein: ENSMUSP00000118381
Gene: ENSMUSG00000040938

DomainStartEndE-ValueType
Pfam:MFS_1 16 196 2e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000126388
AA Change: D266G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116648
Gene: ENSMUSG00000040938
AA Change: D266G

DomainStartEndE-ValueType
Pfam:MFS_1 17 340 5.5e-24 PFAM
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 380 402 N/A INTRINSIC
low complexity region 407 420 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131468
Predicted Effect probably damaging
Transcript: ENSMUST00000136328
AA Change: D218G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115212
Gene: ENSMUSG00000040938
AA Change: D218G

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:MFS_1 66 297 8.3e-10 PFAM
low complexity region 306 324 N/A INTRINSIC
transmembrane domain 332 354 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141290
SMART Domains Protein: ENSMUSP00000116316
Gene: ENSMUSG00000044367

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144494
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149880
Predicted Effect probably null
Transcript: ENSMUST00000153993
SMART Domains Protein: ENSMUSP00000122586
Gene: ENSMUSG00000040938

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 56 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159867
SMART Domains Protein: ENSMUSP00000124687
Gene: ENSMUSG00000044367

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171032
AA Change: D266G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128419
Gene: ENSMUSG00000040938
AA Change: D266G

DomainStartEndE-ValueType
Pfam:MFS_1 17 316 1.8e-24 PFAM
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 380 402 N/A INTRINSIC
low complexity region 407 420 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190533
Meta Mutation Damage Score 0.5982 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1h A G 17: 25,380,627 V1588A probably damaging Het
Card6 T A 15: 5,101,054 M287L probably damaging Het
Fam227b T A 2: 126,116,125 Y240F possibly damaging Het
Fbln1 T A 15: 85,231,556 probably null Het
Fndc5 A G 4: 129,142,529 probably null Het
Gm10799 C A 2: 104,068,064 A99S possibly damaging Het
Gm27013 A T 6: 130,677,765 S245T possibly damaging Het
Gm5592 A G 7: 41,286,448 T125A probably benign Het
Gml2 T C 15: 74,824,339 probably benign Het
Gpbp1 A T 13: 111,448,964 N149K possibly damaging Het
Gprc6a T C 10: 51,628,543 I68M probably benign Het
Hnrnpu T C 1: 178,330,803 probably benign Het
Irf5 A G 6: 29,534,001 probably null Het
Lrp2 T A 2: 69,467,169 K3149N probably benign Het
Lrrn3 A G 12: 41,454,042 V92A probably benign Het
Map3k12 T C 15: 102,505,402 T45A probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Olfr1283 T A 2: 111,369,280 I216K possibly damaging Het
Olfr466 A G 13: 65,152,700 T159A probably benign Het
Osr2 T C 15: 35,300,471 Y58H possibly damaging Het
Pop5 C T 5: 115,240,777 probably benign Het
Ror2 A G 13: 53,118,961 C211R probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sgsm2 C A 11: 74,851,766 R957L probably damaging Het
Spag17 T A 3: 100,103,378 Y2063N probably benign Het
Usp25 A C 16: 77,115,453 K1020T probably damaging Het
Vmn1r23 T C 6: 57,926,368 I142V probably benign Het
Vmn1r235 A G 17: 21,261,592 K60E probably damaging Het
Vmn2r33 A C 7: 7,551,230 F775V probably damaging Het
Vps13b C T 15: 35,709,294 P1796S probably damaging Het
Vwa3a G A 7: 120,778,926 V480I probably benign Het
Other mutations in Slc16a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02678:Slc16a11 APN 11 70215416 missense probably damaging 0.99
shanxi UTSW 11 70215651 nonsense probably null
taihang UTSW 11 70215734 unclassified probably null
R0619:Slc16a11 UTSW 11 70215032 missense probably damaging 1.00
R2044:Slc16a11 UTSW 11 70215651 nonsense probably null
R2110:Slc16a11 UTSW 11 70215320 missense probably damaging 1.00
R4633:Slc16a11 UTSW 11 70216379 unclassified probably null
R5255:Slc16a11 UTSW 11 70215432 missense probably damaging 1.00
R5544:Slc16a11 UTSW 11 70215000 unclassified probably null
R5901:Slc16a11 UTSW 11 70216346 missense probably benign 0.02
R6116:Slc16a11 UTSW 11 70215436 missense probably benign 0.08
R6993:Slc16a11 UTSW 11 70216016 missense possibly damaging 0.60
R7658:Slc16a11 UTSW 11 70215317 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCGCCTTGCTAAGACCTTTAG -3'
(R):5'- AACCAGTGGGGCATAACTC -3'

Sequencing Primer
(F):5'- AAGACCTTTAGCTCTCTCTGGTGAC -3'
(R):5'- AGTGGGGCATAACTCCCAGC -3'
Posted On2015-07-07