Mutagenetix > Incidental Mutations

Incidental Mutation 'R4408:Lrrn3'

327767

Institutional Source

Beutler Lab

Gene Symbol

Lrrn3

Ensembl Gene

ENSMUSG00000036295

Gene Name

leucine rich repeat protein 3, neuronal

Synonyms

NLRR-3

MMRRC Submission

041690-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.183) question?

Stock #

R4408 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

41451668-41486431 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 41454042 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 92 (V92A)

Ref Sequence

ENSEMBL: ENSMUSP00000043818 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043884] [ENSMUST00000132121] [ENSMUST00000134965]

Predicted Effect

probably benign
Transcript: ENSMUST00000043884
AA Change: V92A

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000043818
Gene: ENSMUSG00000036295
AA Change: V92A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
LRRNT	28	73	9.17e-4	SMART
LRR	115	138	2.63e0	SMART
LRR_TYP	139	162	1.5e-4	SMART
LRR	163	186	7.55e-1	SMART
LRR	187	210	1.76e1	SMART
LRR	211	234	1.62e1	SMART
LRR	235	258	5.11e0	SMART
LRR	260	282	3.18e1	SMART
LRR	333	356	4.44e0	SMART
LRRCT	368	420	3.7e-5	SMART
IGc2	435	503	5.04e-9	SMART
FN3	521	602	3.49e0	SMART
transmembrane domain	626	648	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000132121

SMART Domains

Protein: ENSMUSP00000118779
Gene: ENSMUSG00000056899

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S24	38	115	7.7e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000134965

SMART Domains

Protein: ENSMUSP00000116441
Gene: ENSMUSG00000056899

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S24	38	114	6.4e-11	PFAM

Meta Mutation Damage Score

0.0600

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.6%

Validation Efficiency

97% (35/36)

MGI Phenotype

PHENOTYPE: Homozygous null mutant mice exhibited increased mean percent body fat and male homozygous mutant mice exhibited enhanced glucose tolerance when compared with controls. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cacna1h	A	G	17: 25,380,627	V1588A	probably damaging	Het
Card6	T	A	15: 5,101,054	M287L	probably damaging	Het
Fam227b	T	A	2: 126,116,125	Y240F	possibly damaging	Het
Fbln1	T	A	15: 85,231,556		probably null	Het
Fndc5	A	G	4: 129,142,529		probably null	Het
Gm10799	C	A	2: 104,068,064	A99S	possibly damaging	Het
Gm27013	A	T	6: 130,677,765	S245T	possibly damaging	Het
Gm5592	A	G	7: 41,286,448	T125A	probably benign	Het
Gml2	T	C	15: 74,824,339		probably benign	Het
Gpbp1	A	T	13: 111,448,964	N149K	possibly damaging	Het
Gprc6a	T	C	10: 51,628,543	I68M	probably benign	Het
Hnrnpu	T	C	1: 178,330,803		probably benign	Het
Irf5	A	G	6: 29,534,001		probably null	Het
Lrp2	T	A	2: 69,467,169	K3149N	probably benign	Het
Map3k12	T	C	15: 102,505,402	T45A	probably damaging	Het
Myof	A	G	19: 37,922,978	S1502P	probably damaging	Het
Olfr1283	T	A	2: 111,369,280	I216K	possibly damaging	Het
Olfr466	A	G	13: 65,152,700	T159A	probably benign	Het
Osr2	T	C	15: 35,300,471	Y58H	possibly damaging	Het
Pop5	C	T	5: 115,240,777		probably benign	Het
Ror2	A	G	13: 53,118,961	C211R	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sgsm2	C	A	11: 74,851,766	R957L	probably damaging	Het
Slc16a11	A	G	11: 70,215,734		probably null	Het
Spag17	T	A	3: 100,103,378	Y2063N	probably benign	Het
Usp25	A	C	16: 77,115,453	K1020T	probably damaging	Het
Vmn1r23	T	C	6: 57,926,368	I142V	probably benign	Het
Vmn1r235	A	G	17: 21,261,592	K60E	probably damaging	Het
Vmn2r33	A	C	7: 7,551,230	F775V	probably damaging	Het
Vps13b	C	T	15: 35,709,294	P1796S	probably damaging	Het
Vwa3a	G	A	7: 120,778,926	V480I	probably benign	Het

Other mutations in Lrrn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00434:Lrrn3	APN	12	41452192	intron	probably benign
IGL02825:Lrrn3	APN	12	41452593	missense	probably damaging	1.00
IGL02927:Lrrn3	APN	12	41453344	missense	probably damaging	1.00
IGL02970:Lrrn3	APN	12	41452360	missense	probably benign
IGL02995:Lrrn3	APN	12	41452217	missense	probably damaging	1.00
IGL02999:Lrrn3	APN	12	41452751	missense	probably benign	0.01
IGL03182:Lrrn3	APN	12	41454021	missense	probably damaging	1.00
IGL03280:Lrrn3	APN	12	41454147	missense	probably damaging	0.97
PIT4469001:Lrrn3	UTSW	12	41453018	missense	probably benign	0.03
R0167:Lrrn3	UTSW	12	41454015	missense	probably damaging	1.00
R0414:Lrrn3	UTSW	12	41453940	missense	probably damaging	1.00
R0787:Lrrn3	UTSW	12	41454231	missense	probably damaging	1.00
R0894:Lrrn3	UTSW	12	41454034	missense	probably damaging	1.00
R1433:Lrrn3	UTSW	12	41452584	missense	possibly damaging	0.74
R1610:Lrrn3	UTSW	12	41452993	missense	possibly damaging	0.89
R1834:Lrrn3	UTSW	12	41453518	missense	probably damaging	1.00
R2068:Lrrn3	UTSW	12	41452996	missense	probably damaging	1.00
R2871:Lrrn3	UTSW	12	41452723	missense	probably benign	0.00
R2871:Lrrn3	UTSW	12	41452723	missense	probably benign	0.00
R3771:Lrrn3	UTSW	12	41452870	missense	probably damaging	1.00
R4410:Lrrn3	UTSW	12	41452584	missense	possibly damaging	0.74
R4684:Lrrn3	UTSW	12	41454244	missense	possibly damaging	0.75
R4770:Lrrn3	UTSW	12	41452443	missense	probably benign	0.08
R4927:Lrrn3	UTSW	12	41453125	missense	probably damaging	1.00
R5037:Lrrn3	UTSW	12	41453595	missense	probably damaging	1.00
R5482:Lrrn3	UTSW	12	41452387	missense	probably benign	0.01
R5482:Lrrn3	UTSW	12	41452388	missense	probably damaging	0.96
R5667:Lrrn3	UTSW	12	41452298	missense	possibly damaging	0.77
R6022:Lrrn3	UTSW	12	41453430	missense	probably damaging	0.96
R6087:Lrrn3	UTSW	12	41453535	missense	possibly damaging	0.84
R6129:Lrrn3	UTSW	12	41453788	nonsense	probably null
R6309:Lrrn3	UTSW	12	41453206	missense	probably damaging	1.00
R7449:Lrrn3	UTSW	12	41453488	missense	probably damaging	1.00
R7555:Lrrn3	UTSW	12	41452911	missense	probably benign	0.01
R7560:Lrrn3	UTSW	12	41452713	missense	possibly damaging	0.93
R8059:Lrrn3	UTSW	12	41454217	missense	probably benign	0.22
R8134:Lrrn3	UTSW	12	41453048	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCGGAGAAGATTATGTAGGCC -3'
(R):5'- TGAGATCAGGCCTTGGTTTAC -3'

Sequencing Primer
(F):5'- CCAATGAAGGCTCCGGGAG -3'
(R):5'- GGTTTACCCCGAGATCCATCTATATG -3'

Posted On

2015-07-07