Mutagenetix > Incidental Mutations

Incidental Mutation 'R4408:Gpbp1'

327770

Institutional Source

Beutler Lab

Gene Symbol

Gpbp1

Ensembl Gene

ENSMUSG00000032745

Gene Name

GC-rich promoter binding protein 1

Synonyms

1700034P14Rik, D230035M11Rik

MMRRC Submission

041690-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4408 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

111425680-111490111 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 111448964 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 149 (N149K)

Ref Sequence

ENSEMBL: ENSMUSP00000155119 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047627] [ENSMUST00000091236] [ENSMUST00000136471] [ENSMUST00000231096]

Predicted Effect

probably benign
Transcript: ENSMUST00000047627
AA Change: N149K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000048240
Gene: ENSMUSG00000032745
AA Change: N149K

Domain	Start	End	E-Value	Type
low complexity region	232	243	N/A	INTRINSIC
Pfam:Vasculin	395	491	1.9e-45	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000091236
AA Change: N149K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000088777
Gene: ENSMUSG00000032745
AA Change: N149K

Domain	Start	End	E-Value	Type
low complexity region	212	223	N/A	INTRINSIC
Pfam:Vasculin	374	471	1.3e-46	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129638

Predicted Effect

probably benign
Transcript: ENSMUST00000136471

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143331

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156221

Predicted Effect

possibly damaging
Transcript: ENSMUST00000231096
AA Change: N149K

PolyPhen 2 Score 0.628 (Sensitivity: 0.87; Specificity: 0.91)

Meta Mutation Damage Score

0.0649

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.6%

Validation Efficiency

97% (35/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was originally isolated by subtractive hybridization of cDNAs expressed in atherosclerotic plaques with a thrombus, and was found to be expressed only in vascular smooth muscle cells. However, a shorter splice variant was found to be more ubiquitously expressed. This protein is suggested to play a role in the development of atherosclerosis. Studies in mice suggest that it may also function as a GC-rich promoter-specific trans-activating transcription factor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cacna1h	A	G	17: 25,380,627	V1588A	probably damaging	Het
Card6	T	A	15: 5,101,054	M287L	probably damaging	Het
Fam227b	T	A	2: 126,116,125	Y240F	possibly damaging	Het
Fbln1	T	A	15: 85,231,556		probably null	Het
Fndc5	A	G	4: 129,142,529		probably null	Het
Gm10799	C	A	2: 104,068,064	A99S	possibly damaging	Het
Gm27013	A	T	6: 130,677,765	S245T	possibly damaging	Het
Gm5592	A	G	7: 41,286,448	T125A	probably benign	Het
Gml2	T	C	15: 74,824,339		probably benign	Het
Gprc6a	T	C	10: 51,628,543	I68M	probably benign	Het
Hnrnpu	T	C	1: 178,330,803		probably benign	Het
Irf5	A	G	6: 29,534,001		probably null	Het
Lrp2	T	A	2: 69,467,169	K3149N	probably benign	Het
Lrrn3	A	G	12: 41,454,042	V92A	probably benign	Het
Map3k12	T	C	15: 102,505,402	T45A	probably damaging	Het
Myof	A	G	19: 37,922,978	S1502P	probably damaging	Het
Olfr1283	T	A	2: 111,369,280	I216K	possibly damaging	Het
Olfr466	A	G	13: 65,152,700	T159A	probably benign	Het
Osr2	T	C	15: 35,300,471	Y58H	possibly damaging	Het
Pop5	C	T	5: 115,240,777		probably benign	Het
Ror2	A	G	13: 53,118,961	C211R	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sgsm2	C	A	11: 74,851,766	R957L	probably damaging	Het
Slc16a11	A	G	11: 70,215,734		probably null	Het
Spag17	T	A	3: 100,103,378	Y2063N	probably benign	Het
Usp25	A	C	16: 77,115,453	K1020T	probably damaging	Het
Vmn1r23	T	C	6: 57,926,368	I142V	probably benign	Het
Vmn1r235	A	G	17: 21,261,592	K60E	probably damaging	Het
Vmn2r33	A	C	7: 7,551,230	F775V	probably damaging	Het
Vps13b	C	T	15: 35,709,294	P1796S	probably damaging	Het
Vwa3a	G	A	7: 120,778,926	V480I	probably benign	Het

Other mutations in Gpbp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00591:Gpbp1	APN	13	111440750	missense	probably damaging	0.96
IGL01360:Gpbp1	APN	13	111426541	utr 3 prime	probably benign
IGL01609:Gpbp1	APN	13	111439202	missense	possibly damaging	0.62
IGL01747:Gpbp1	APN	13	111453050	missense	probably damaging	0.99
IGL02614:Gpbp1	APN	13	111436473	missense	probably benign	0.01
IGL03329:Gpbp1	APN	13	111453253	splice site	probably benign
R0315:Gpbp1	UTSW	13	111436538	missense	possibly damaging	0.50
R0510:Gpbp1	UTSW	13	111440745	missense	possibly damaging	0.58
R1549:Gpbp1	UTSW	13	111436579	missense	probably benign	0.00
R1582:Gpbp1	UTSW	13	111436532	splice site	probably null
R1762:Gpbp1	UTSW	13	111440774	missense	probably benign	0.02
R2074:Gpbp1	UTSW	13	111453407	missense	probably benign	0.18
R2276:Gpbp1	UTSW	13	111466978	splice site	probably null
R3685:Gpbp1	UTSW	13	111466871	missense	probably benign	0.06
R4307:Gpbp1	UTSW	13	111448983	makesense	probably null
R4840:Gpbp1	UTSW	13	111440630	critical splice donor site	probably null
R4952:Gpbp1	UTSW	13	111440750	missense	probably damaging	0.96
R5152:Gpbp1	UTSW	13	111453281	intron	probably benign
R5376:Gpbp1	UTSW	13	111426642	missense	probably damaging	1.00
R6143:Gpbp1	UTSW	13	111466855	missense	probably damaging	0.98
R6378:Gpbp1	UTSW	13	111433612	missense	probably damaging	1.00
R6516:Gpbp1	UTSW	13	111453102	missense	probably benign	0.05
R6687:Gpbp1	UTSW	13	111438085	missense	possibly damaging	0.78
R6745:Gpbp1	UTSW	13	111453385	missense	probably benign	0.05
R7186:Gpbp1	UTSW	13	111440699	missense	possibly damaging	0.89
R7310:Gpbp1	UTSW	13	111453390	missense	probably benign	0.02
R7669:Gpbp1	UTSW	13	111439124	missense	probably benign	0.16
R7881:Gpbp1	UTSW	13	111439199	missense	possibly damaging	0.45

Predicted Primers

PCR Primer
(F):5'- ATCAAGTTTATACCCCAAAGTCTCC -3'
(R):5'- TGTCTCCAACTAGCAATGGTTAGC -3'

Sequencing Primer
(F):5'- ATACCCCAAAGTCTCCTTTTTAAAG -3'
(R):5'- CTAGCAATGGTTAGCAAAGAAAATTG -3'

Posted On

2015-07-07