Incidental Mutation 'R4408:Card6'
List |< first << previous [record 2 of 32] next >> last >|
ID327771
Institutional Source Beutler Lab
Gene Symbol Card6
Ensembl Gene ENSMUSG00000041849
Gene Namecaspase recruitment domain family, member 6
Synonyms
MMRRC Submission 041690-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4408 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location5095981-5108539 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5101054 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 287 (M287L)
Ref Sequence ENSEMBL: ENSMUSP00000112833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118365] [ENSMUST00000141020]
Predicted Effect probably damaging
Transcript: ENSMUST00000118365
AA Change: M287L

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112833
Gene: ENSMUSG00000041849
AA Change: M287L

DomainStartEndE-ValueType
CARD 3 89 2.13e-5 SMART
low complexity region 237 245 N/A INTRINSIC
low complexity region 257 273 N/A INTRINSIC
Blast:PGAM 278 656 7e-45 BLAST
low complexity region 919 935 N/A INTRINSIC
low complexity region 946 961 N/A INTRINSIC
internal_repeat_1 962 1041 6.5e-13 PROSPERO
internal_repeat_1 1039 1101 6.5e-13 PROSPERO
low complexity region 1107 1132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141020
SMART Domains Protein: ENSMUSP00000118817
Gene: ENSMUSG00000041849

DomainStartEndE-ValueType
CARD 3 89 2.13e-5 SMART
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a caspase recruitment domain (CARD), an antiparallel six-helical bundle that mediates homotypic protein-protein interactions. The encoded protein is a microtubule-associated protein that has been shown to interact with receptor-interacting protein kinases and positively modulate signal transduction pathways converging on activation of the inducible transcription factor NF-kB. [provided by RefSeq, Jul 2008]
PHENOTYPE: Knockout mice are viable and grossly normal with no deficits in thymocytes, granulocytes, macrophages, NK cells or T- and B-cell subsets. Various signaling pathways mediating innate and adaptive immune responses appear unaltered. Mice are normally resistant to infection by a wide range of pathogens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1h A G 17: 25,380,627 V1588A probably damaging Het
Fam227b T A 2: 126,116,125 Y240F possibly damaging Het
Fbln1 T A 15: 85,231,556 probably null Het
Fndc5 A G 4: 129,142,529 probably null Het
Gm10799 C A 2: 104,068,064 A99S possibly damaging Het
Gm27013 A T 6: 130,677,765 S245T possibly damaging Het
Gm5592 A G 7: 41,286,448 T125A probably benign Het
Gml2 T C 15: 74,824,339 probably benign Het
Gpbp1 A T 13: 111,448,964 N149K possibly damaging Het
Gprc6a T C 10: 51,628,543 I68M probably benign Het
Hnrnpu T C 1: 178,330,803 probably benign Het
Irf5 A G 6: 29,534,001 probably null Het
Lrp2 T A 2: 69,467,169 K3149N probably benign Het
Lrrn3 A G 12: 41,454,042 V92A probably benign Het
Map3k12 T C 15: 102,505,402 T45A probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Olfr1283 T A 2: 111,369,280 I216K possibly damaging Het
Olfr466 A G 13: 65,152,700 T159A probably benign Het
Osr2 T C 15: 35,300,471 Y58H possibly damaging Het
Pop5 C T 5: 115,240,777 probably benign Het
Ror2 A G 13: 53,118,961 C211R probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sgsm2 C A 11: 74,851,766 R957L probably damaging Het
Slc16a11 A G 11: 70,215,734 probably null Het
Spag17 T A 3: 100,103,378 Y2063N probably benign Het
Usp25 A C 16: 77,115,453 K1020T probably damaging Het
Vmn1r23 T C 6: 57,926,368 I142V probably benign Het
Vmn1r235 A G 17: 21,261,592 K60E probably damaging Het
Vmn2r33 A C 7: 7,551,230 F775V probably damaging Het
Vps13b C T 15: 35,709,294 P1796S probably damaging Het
Vwa3a G A 7: 120,778,926 V480I probably benign Het
Other mutations in Card6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00755:Card6 APN 15 5098941 missense possibly damaging 0.93
IGL01307:Card6 APN 15 5100002 missense possibly damaging 0.93
IGL02016:Card6 APN 15 5108256 missense probably damaging 1.00
IGL02976:Card6 APN 15 5099828 nonsense probably null
IGL03328:Card6 APN 15 5105445 splice site probably benign
IGL03356:Card6 APN 15 5100241 missense probably benign 0.00
Mark UTSW 15 5098691 small deletion probably benign
sharps UTSW 15 5099896 nonsense probably null
PIT4131001:Card6 UTSW 15 5108306 missense probably damaging 1.00
PIT4142001:Card6 UTSW 15 5098631 missense unknown
PIT4458001:Card6 UTSW 15 5098691 small deletion probably benign
R0562:Card6 UTSW 15 5105166 missense probably damaging 1.00
R0943:Card6 UTSW 15 5100286 missense probably damaging 1.00
R1654:Card6 UTSW 15 5098732 missense probably benign 0.00
R3892:Card6 UTSW 15 5099296 missense probably benign 0.01
R4856:Card6 UTSW 15 5105141 splice site probably null
R4886:Card6 UTSW 15 5105141 splice site probably null
R4998:Card6 UTSW 15 5100082 missense probably benign 0.00
R5050:Card6 UTSW 15 5100376 missense probably benign 0.00
R5365:Card6 UTSW 15 5105406 missense possibly damaging 0.53
R5518:Card6 UTSW 15 5105214 missense probably damaging 0.99
R5686:Card6 UTSW 15 5100953 missense probably damaging 0.99
R6088:Card6 UTSW 15 5105019 missense possibly damaging 0.56
R6194:Card6 UTSW 15 5098444 missense unknown
R6336:Card6 UTSW 15 5099164 nonsense probably null
R6539:Card6 UTSW 15 5105391 missense probably damaging 0.99
R6560:Card6 UTSW 15 5098885 missense probably damaging 1.00
R7132:Card6 UTSW 15 5098691 small deletion probably benign
R7157:Card6 UTSW 15 5100109 missense probably benign 0.07
R7174:Card6 UTSW 15 5098691 small deletion probably benign
R7186:Card6 UTSW 15 5098691 small deletion probably benign
R7338:Card6 UTSW 15 5099872 missense probably benign 0.09
R7430:Card6 UTSW 15 5099200 missense probably benign 0.00
R7579:Card6 UTSW 15 5098691 small deletion probably benign
R7677:Card6 UTSW 15 5098444 missense unknown
R7718:Card6 UTSW 15 5099787 missense possibly damaging 0.54
R7720:Card6 UTSW 15 5098423 missense unknown
R7756:Card6 UTSW 15 5099896 nonsense probably null
R7758:Card6 UTSW 15 5099896 nonsense probably null
R7762:Card6 UTSW 15 5105338 missense probably benign
R7786:Card6 UTSW 15 5098691 small deletion probably benign
R7808:Card6 UTSW 15 5099472 missense probably benign 0.00
R7817:Card6 UTSW 15 5098691 small deletion probably benign
R7822:Card6 UTSW 15 5098865 missense possibly damaging 0.82
R7902:Card6 UTSW 15 5098691 small deletion probably benign
R7977:Card6 UTSW 15 5100525 missense probably damaging 1.00
R7987:Card6 UTSW 15 5100525 missense probably damaging 1.00
R8295:Card6 UTSW 15 5098691 small deletion probably benign
R8303:Card6 UTSW 15 5105365 missense probably benign 0.13
R8431:Card6 UTSW 15 5100276 missense probably damaging 0.98
R8691:Card6 UTSW 15 5099596 missense possibly damaging 0.76
RF013:Card6 UTSW 15 5100142 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- CACCATCTTGTGCCTAAGGG -3'
(R):5'- CTGGCAAACATGACTCAAGAGC -3'

Sequencing Primer
(F):5'- CCTAAGGGTAAAATCTCTGGCTGTC -3'
(R):5'- TGCAGCCAAGAATGCCTTTG -3'
Posted On2015-07-07