Incidental Mutation 'R4408:Osr2'
ID327772
Institutional Source Beutler Lab
Gene Symbol Osr2
Ensembl Gene ENSMUSG00000022330
Gene Nameodd-skipped related 2
Synonyms5430409I15Rik, Osr2B, Osr2A
MMRRC Submission 041690-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4408 (G1)
Quality Score222
Status Validated
Chromosome15
Chromosomal Location35296098-35303305 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35300471 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 58 (Y58H)
Ref Sequence ENSEMBL: ENSMUSP00000154286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022952] [ENSMUST00000228152]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022952
AA Change: Y58H

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022952
Gene: ENSMUSG00000022330
AA Change: Y58H

DomainStartEndE-ValueType
low complexity region 136 153 N/A INTRINSIC
ZnF_C2H2 172 194 2.05e-2 SMART
ZnF_C2H2 200 222 2.4e-3 SMART
ZnF_C2H2 228 250 4.4e-2 SMART
low complexity region 253 263 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226838
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227655
Predicted Effect possibly damaging
Transcript: ENSMUST00000228152
AA Change: Y58H

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228684
Meta Mutation Damage Score 0.3826 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] OSR2 is a mammalian homolog of the Drosophila odd-skipped family of transcription factors (Lan et al., 2004 [PubMed 15175245]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null mice display neonatal lethality, cleft of the secondary palate, and thickened tympanic rings. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1h A G 17: 25,380,627 V1588A probably damaging Het
Card6 T A 15: 5,101,054 M287L probably damaging Het
Fam227b T A 2: 126,116,125 Y240F possibly damaging Het
Fbln1 T A 15: 85,231,556 probably null Het
Fndc5 A G 4: 129,142,529 probably null Het
Gm10799 C A 2: 104,068,064 A99S possibly damaging Het
Gm27013 A T 6: 130,677,765 S245T possibly damaging Het
Gm5592 A G 7: 41,286,448 T125A probably benign Het
Gml2 T C 15: 74,824,339 probably benign Het
Gpbp1 A T 13: 111,448,964 N149K possibly damaging Het
Gprc6a T C 10: 51,628,543 I68M probably benign Het
Hnrnpu T C 1: 178,330,803 probably benign Het
Irf5 A G 6: 29,534,001 probably null Het
Lrp2 T A 2: 69,467,169 K3149N probably benign Het
Lrrn3 A G 12: 41,454,042 V92A probably benign Het
Map3k12 T C 15: 102,505,402 T45A probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Olfr1283 T A 2: 111,369,280 I216K possibly damaging Het
Olfr466 A G 13: 65,152,700 T159A probably benign Het
Pop5 C T 5: 115,240,777 probably benign Het
Ror2 A G 13: 53,118,961 C211R probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sgsm2 C A 11: 74,851,766 R957L probably damaging Het
Slc16a11 A G 11: 70,215,734 probably null Het
Spag17 T A 3: 100,103,378 Y2063N probably benign Het
Usp25 A C 16: 77,115,453 K1020T probably damaging Het
Vmn1r23 T C 6: 57,926,368 I142V probably benign Het
Vmn1r235 A G 17: 21,261,592 K60E probably damaging Het
Vmn2r33 A C 7: 7,551,230 F775V probably damaging Het
Vps13b C T 15: 35,709,294 P1796S probably damaging Het
Vwa3a G A 7: 120,778,926 V480I probably benign Het
Other mutations in Osr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02008:Osr2 APN 15 35301992 missense probably damaging 1.00
IGL02627:Osr2 APN 15 35300454 missense possibly damaging 0.91
IGL03371:Osr2 APN 15 35300854 nonsense probably null
R1517:Osr2 UTSW 15 35300667 missense probably benign
R1893:Osr2 UTSW 15 35300462 missense possibly damaging 0.91
R7275:Osr2 UTSW 15 35300886 missense probably damaging 1.00
R8157:Osr2 UTSW 15 35301917 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTCGGAGCCTTCAGGAAGATG -3'
(R):5'- CCATTTTAGGAGGATCTTCTTGC -3'

Sequencing Primer
(F):5'- CCTTCAGGAAGATGGGGAGC -3'
(R):5'- CCAAGTTGGCAAAGTCAAAACG -3'
Posted On2015-07-07