Mutagenetix > Incidental Mutations

Incidental Mutation 'R4408:Gml2'

327774

Institutional Source

Beutler Lab

Gene Symbol

Gml2

Ensembl Gene

ENSMUSG00000068600

Gene Name

glycosylphosphatidylinositol anchored molecule like 2

Synonyms

Hemt1, hematopoietic cell-specific transcript, HemT, 1700057K19Rik

MMRRC Submission

041690-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.053) question?

Stock #

R4408 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

74819071-74834871 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

T to C at 74824339 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000141185 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096399] [ENSMUST00000188180]

Predicted Effect

probably benign
Transcript: ENSMUST00000096399

SMART Domains

Protein: ENSMUSP00000094130
Gene: ENSMUSG00000068600

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
LU	47	141	2.06e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186752

Predicted Effect

probably benign
Transcript: ENSMUST00000188180

SMART Domains

Protein: ENSMUSP00000141185
Gene: ENSMUSG00000068600

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Blast:LU	47	80	2e-15	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188458

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.6%

Validation Efficiency

97% (35/36)

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cacna1h	A	G	17: 25,380,627	V1588A	probably damaging	Het
Card6	T	A	15: 5,101,054	M287L	probably damaging	Het
Fam227b	T	A	2: 126,116,125	Y240F	possibly damaging	Het
Fbln1	T	A	15: 85,231,556		probably null	Het
Fndc5	A	G	4: 129,142,529		probably null	Het
Gm10799	C	A	2: 104,068,064	A99S	possibly damaging	Het
Gm27013	A	T	6: 130,677,765	S245T	possibly damaging	Het
Gm5592	A	G	7: 41,286,448	T125A	probably benign	Het
Gpbp1	A	T	13: 111,448,964	N149K	possibly damaging	Het
Gprc6a	T	C	10: 51,628,543	I68M	probably benign	Het
Hnrnpu	T	C	1: 178,330,803		probably benign	Het
Irf5	A	G	6: 29,534,001		probably null	Het
Lrp2	T	A	2: 69,467,169	K3149N	probably benign	Het
Lrrn3	A	G	12: 41,454,042	V92A	probably benign	Het
Map3k12	T	C	15: 102,505,402	T45A	probably damaging	Het
Myof	A	G	19: 37,922,978	S1502P	probably damaging	Het
Olfr1283	T	A	2: 111,369,280	I216K	possibly damaging	Het
Olfr466	A	G	13: 65,152,700	T159A	probably benign	Het
Osr2	T	C	15: 35,300,471	Y58H	possibly damaging	Het
Pop5	C	T	5: 115,240,777		probably benign	Het
Ror2	A	G	13: 53,118,961	C211R	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sgsm2	C	A	11: 74,851,766	R957L	probably damaging	Het
Slc16a11	A	G	11: 70,215,734		probably null	Het
Spag17	T	A	3: 100,103,378	Y2063N	probably benign	Het
Usp25	A	C	16: 77,115,453	K1020T	probably damaging	Het
Vmn1r23	T	C	6: 57,926,368	I142V	probably benign	Het
Vmn1r235	A	G	17: 21,261,592	K60E	probably damaging	Het
Vmn2r33	A	C	7: 7,551,230	F775V	probably damaging	Het
Vps13b	C	T	15: 35,709,294	P1796S	probably damaging	Het
Vwa3a	G	A	7: 120,778,926	V480I	probably benign	Het

Other mutations in Gml2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01649:Gml2	APN	15	74824221	nonsense	probably null
R0031:Gml2	UTSW	15	74824276	missense	probably benign	0.12
R0608:Gml2	UTSW	15	74821386	critical splice donor site	probably null
R1087:Gml2	UTSW	15	74824097	missense	possibly damaging	0.73
R1130:Gml2	UTSW	15	74821346	missense	probably damaging	0.99
R1503:Gml2	UTSW	15	74821352	nonsense	probably null
R6802:Gml2	UTSW	15	74824246	missense	probably damaging	1.00
R7351:Gml2	UTSW	15	74821376	missense	possibly damaging	0.57
R7833:Gml2	UTSW	15	74821368	nonsense	probably null
R7910:Gml2	UTSW	15	74820530	critical splice acceptor site	probably null
R8513:Gml2	UTSW	15	74824155	missense	probably damaging	1.00
X0066:Gml2	UTSW	15	74824050	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GTATAACTTGCAATGTGGGAGGC -3'
(R):5'- CTCCTAAGGTGATGGAGTAGGG -3'

Sequencing Primer
(F):5'- CCCCACTAATTTAGAGAGGGACTTG -3'
(R):5'- TAGGGATGACCAAATCTGAGC -3'

Posted On

2015-07-07