Mutagenetix > Incidental Mutations

Incidental Mutation 'R4408:Map3k12'

327776

Institutional Source

Beutler Lab

Gene Symbol

Map3k12

Ensembl Gene

ENSMUSG00000023050

Gene Name

mitogen-activated protein kinase kinase kinase 12

Synonyms

MUK, DLK, Zpk

MMRRC Submission

041690-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4408 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102497646-102517064 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 102505402 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 45 (T45A)

Ref Sequence

ENSEMBL: ENSMUSP00000127629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023812] [ENSMUST00000096145] [ENSMUST00000165174] [ENSMUST00000169162] [ENSMUST00000169367] [ENSMUST00000169377] [ENSMUST00000171565]

Predicted Effect

probably damaging
Transcript: ENSMUST00000023812
AA Change: T45A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000023812
Gene: ENSMUSG00000023050
AA Change: T45A

Domain	Start	End	E-Value	Type
low complexity region	54	75	N/A	INTRINSIC
Pfam:Pkinase	158	397	3.3e-59	PFAM
Pfam:Pkinase_Tyr	159	397	2.7e-62	PFAM
coiled coil region	447	501	N/A	INTRINSIC
low complexity region	559	577	N/A	INTRINSIC
low complexity region	599	617	N/A	INTRINSIC
low complexity region	640	663	N/A	INTRINSIC
low complexity region	664	678	N/A	INTRINSIC
low complexity region	691	727	N/A	INTRINSIC
low complexity region	751	764	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000096145

SMART Domains

Protein: ENSMUSP00000093859
Gene: ENSMUSG00000071586

Domain	Start	End	E-Value	Type
low complexity region	29	37	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164343

Predicted Effect

probably benign
Transcript: ENSMUST00000165174

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167677

Predicted Effect

probably benign
Transcript: ENSMUST00000169162

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169367
AA Change: T45A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

Predicted Effect

probably damaging
Transcript: ENSMUST00000169377
AA Change: T45A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000133209
Gene: ENSMUSG00000023050
AA Change: T45A

Domain	Start	End	E-Value	Type
low complexity region	54	75	N/A	INTRINSIC
Pfam:Pkinase	159	397	1.2e-58	PFAM
Pfam:Pkinase_Tyr	160	397	3.7e-62	PFAM
coiled coil region	447	501	N/A	INTRINSIC
low complexity region	559	577	N/A	INTRINSIC
low complexity region	599	617	N/A	INTRINSIC
low complexity region	640	663	N/A	INTRINSIC
low complexity region	664	678	N/A	INTRINSIC
low complexity region	691	727	N/A	INTRINSIC
low complexity region	751	764	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000171565
AA Change: T45A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000127629
Gene: ENSMUSG00000023050
AA Change: T45A

Domain	Start	End	E-Value	Type
low complexity region	54	75	N/A	INTRINSIC
Pfam:Pkinase	158	397	3.3e-59	PFAM
Pfam:Pkinase_Tyr	159	397	2.7e-62	PFAM
coiled coil region	447	501	N/A	INTRINSIC
low complexity region	559	577	N/A	INTRINSIC
low complexity region	599	617	N/A	INTRINSIC
low complexity region	640	663	N/A	INTRINSIC
low complexity region	664	678	N/A	INTRINSIC
low complexity region	691	727	N/A	INTRINSIC
low complexity region	751	764	N/A	INTRINSIC

Meta Mutation Damage Score

0.0949

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.6%

Validation Efficiency

97% (35/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family. This kinase contains a leucine-zipper domain and is predominately expressed in neuronal cells. The phosphorylation state of this kinase in synaptic terminals was shown to be regulated by membrane depolarization via calcineurin. This kinase forms heterodimers with leucine zipper containing transcription factors, such as cAMP responsive element binding protein (CREB) and MYC, and thus may play a regulatory role in PKA or retinoic acid induced neuronal differentiation. Alternatively spliced transcript variants encoding different proteins have been described.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a gene-trapped allele lack the brain anterior commissure. Mice homozygous for a knock-out allele exhibit postnatal lethality and abnormal axon growth and radial migration of neocortical pyramidal neurons. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cacna1h	A	G	17: 25,380,627	V1588A	probably damaging	Het
Card6	T	A	15: 5,101,054	M287L	probably damaging	Het
Fam227b	T	A	2: 126,116,125	Y240F	possibly damaging	Het
Fbln1	T	A	15: 85,231,556		probably null	Het
Fndc5	A	G	4: 129,142,529		probably null	Het
Gm10799	C	A	2: 104,068,064	A99S	possibly damaging	Het
Gm27013	A	T	6: 130,677,765	S245T	possibly damaging	Het
Gm5592	A	G	7: 41,286,448	T125A	probably benign	Het
Gml2	T	C	15: 74,824,339		probably benign	Het
Gpbp1	A	T	13: 111,448,964	N149K	possibly damaging	Het
Gprc6a	T	C	10: 51,628,543	I68M	probably benign	Het
Hnrnpu	T	C	1: 178,330,803		probably benign	Het
Irf5	A	G	6: 29,534,001		probably null	Het
Lrp2	T	A	2: 69,467,169	K3149N	probably benign	Het
Lrrn3	A	G	12: 41,454,042	V92A	probably benign	Het
Myof	A	G	19: 37,922,978	S1502P	probably damaging	Het
Olfr1283	T	A	2: 111,369,280	I216K	possibly damaging	Het
Olfr466	A	G	13: 65,152,700	T159A	probably benign	Het
Osr2	T	C	15: 35,300,471	Y58H	possibly damaging	Het
Pop5	C	T	5: 115,240,777		probably benign	Het
Ror2	A	G	13: 53,118,961	C211R	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sgsm2	C	A	11: 74,851,766	R957L	probably damaging	Het
Slc16a11	A	G	11: 70,215,734		probably null	Het
Spag17	T	A	3: 100,103,378	Y2063N	probably benign	Het
Usp25	A	C	16: 77,115,453	K1020T	probably damaging	Het
Vmn1r23	T	C	6: 57,926,368	I142V	probably benign	Het
Vmn1r235	A	G	17: 21,261,592	K60E	probably damaging	Het
Vmn2r33	A	C	7: 7,551,230	F775V	probably damaging	Het
Vps13b	C	T	15: 35,709,294	P1796S	probably damaging	Het
Vwa3a	G	A	7: 120,778,926	V480I	probably benign	Het

Other mutations in Map3k12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01615:Map3k12	APN	15	102503751	missense	probably damaging	1.00
IGL01713:Map3k12	APN	15	102502321	missense	probably damaging	1.00
IGL01720:Map3k12	APN	15	102502186	unclassified	probably benign
IGL02262:Map3k12	APN	15	102502075	missense	probably damaging	1.00
IGL02670:Map3k12	APN	15	102503546	missense	probably benign	0.09
IGL03004:Map3k12	APN	15	102504196	missense	possibly damaging	0.96
IGL03369:Map3k12	APN	15	102502079	missense	possibly damaging	0.47
react	UTSW	15	102505402	missense	probably damaging	1.00
R0894:Map3k12	UTSW	15	102502178	missense	probably damaging	1.00
R0918:Map3k12	UTSW	15	102503852	missense	probably damaging	0.99
R1547:Map3k12	UTSW	15	102503852	missense	probably damaging	1.00
R1844:Map3k12	UTSW	15	102503535	missense	probably damaging	1.00
R1880:Map3k12	UTSW	15	102502064	critical splice donor site	probably null
R2292:Map3k12	UTSW	15	102500139	missense	probably damaging	0.96
R4397:Map3k12	UTSW	15	102501259	missense	probably benign	0.44
R4406:Map3k12	UTSW	15	102505402	missense	probably damaging	1.00
R4407:Map3k12	UTSW	15	102505402	missense	probably damaging	1.00
R4731:Map3k12	UTSW	15	102501282	missense	probably benign	0.28
R5074:Map3k12	UTSW	15	102501832	critical splice donor site	probably null
R5605:Map3k12	UTSW	15	102503865	missense	probably benign	0.17
R5848:Map3k12	UTSW	15	102504235	missense	possibly damaging	0.66
R6232:Map3k12	UTSW	15	102503646	missense	probably damaging	0.99
R6901:Map3k12	UTSW	15	102500629	missense	possibly damaging	0.95
R6901:Map3k12	UTSW	15	102500630	missense	possibly damaging	0.65
R6946:Map3k12	UTSW	15	102505134	missense	possibly damaging	0.89
R7291:Map3k12	UTSW	15	102502166	missense	probably damaging	1.00
R7874:Map3k12	UTSW	15	102500642	missense	possibly damaging	0.91
R7957:Map3k12	UTSW	15	102500642	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- TAGATGCTCGACTCTCAGGTG -3'
(R):5'- ACCGTGAGCTCTTGCAGTAAC -3'

Sequencing Primer
(F):5'- ACTCTCAGGTGACCCAGTG -3'
(R):5'- AGCTCTTGCAGTAACTGGCTG -3'

Posted On

2015-07-07