Incidental Mutation 'R4408:Map3k12'
ID327776
Institutional Source Beutler Lab
Gene Symbol Map3k12
Ensembl Gene ENSMUSG00000023050
Gene Namemitogen-activated protein kinase kinase kinase 12
SynonymsMUK, DLK, Zpk
MMRRC Submission 041690-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4408 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location102497646-102517064 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102505402 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 45 (T45A)
Ref Sequence ENSEMBL: ENSMUSP00000127629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023812] [ENSMUST00000096145] [ENSMUST00000165174] [ENSMUST00000169162] [ENSMUST00000169367] [ENSMUST00000169377] [ENSMUST00000171565]
Predicted Effect probably damaging
Transcript: ENSMUST00000023812
AA Change: T45A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023812
Gene: ENSMUSG00000023050
AA Change: T45A

DomainStartEndE-ValueType
low complexity region 54 75 N/A INTRINSIC
Pfam:Pkinase 158 397 3.3e-59 PFAM
Pfam:Pkinase_Tyr 159 397 2.7e-62 PFAM
coiled coil region 447 501 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 599 617 N/A INTRINSIC
low complexity region 640 663 N/A INTRINSIC
low complexity region 664 678 N/A INTRINSIC
low complexity region 691 727 N/A INTRINSIC
low complexity region 751 764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096145
SMART Domains Protein: ENSMUSP00000093859
Gene: ENSMUSG00000071586

DomainStartEndE-ValueType
low complexity region 29 37 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164343
Predicted Effect probably benign
Transcript: ENSMUST00000165174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167677
Predicted Effect probably benign
Transcript: ENSMUST00000169162
Predicted Effect possibly damaging
Transcript: ENSMUST00000169367
AA Change: T45A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000169377
AA Change: T45A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133209
Gene: ENSMUSG00000023050
AA Change: T45A

DomainStartEndE-ValueType
low complexity region 54 75 N/A INTRINSIC
Pfam:Pkinase 159 397 1.2e-58 PFAM
Pfam:Pkinase_Tyr 160 397 3.7e-62 PFAM
coiled coil region 447 501 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 599 617 N/A INTRINSIC
low complexity region 640 663 N/A INTRINSIC
low complexity region 664 678 N/A INTRINSIC
low complexity region 691 727 N/A INTRINSIC
low complexity region 751 764 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171565
AA Change: T45A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127629
Gene: ENSMUSG00000023050
AA Change: T45A

DomainStartEndE-ValueType
low complexity region 54 75 N/A INTRINSIC
Pfam:Pkinase 158 397 3.3e-59 PFAM
Pfam:Pkinase_Tyr 159 397 2.7e-62 PFAM
coiled coil region 447 501 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 599 617 N/A INTRINSIC
low complexity region 640 663 N/A INTRINSIC
low complexity region 664 678 N/A INTRINSIC
low complexity region 691 727 N/A INTRINSIC
low complexity region 751 764 N/A INTRINSIC
Meta Mutation Damage Score 0.0949 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family. This kinase contains a leucine-zipper domain and is predominately expressed in neuronal cells. The phosphorylation state of this kinase in synaptic terminals was shown to be regulated by membrane depolarization via calcineurin. This kinase forms heterodimers with leucine zipper containing transcription factors, such as cAMP responsive element binding protein (CREB) and MYC, and thus may play a regulatory role in PKA or retinoic acid induced neuronal differentiation. Alternatively spliced transcript variants encoding different proteins have been described.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a gene-trapped allele lack the brain anterior commissure. Mice homozygous for a knock-out allele exhibit postnatal lethality and abnormal axon growth and radial migration of neocortical pyramidal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1h A G 17: 25,380,627 V1588A probably damaging Het
Card6 T A 15: 5,101,054 M287L probably damaging Het
Fam227b T A 2: 126,116,125 Y240F possibly damaging Het
Fbln1 T A 15: 85,231,556 probably null Het
Fndc5 A G 4: 129,142,529 probably null Het
Gm10799 C A 2: 104,068,064 A99S possibly damaging Het
Gm27013 A T 6: 130,677,765 S245T possibly damaging Het
Gm5592 A G 7: 41,286,448 T125A probably benign Het
Gml2 T C 15: 74,824,339 probably benign Het
Gpbp1 A T 13: 111,448,964 N149K possibly damaging Het
Gprc6a T C 10: 51,628,543 I68M probably benign Het
Hnrnpu T C 1: 178,330,803 probably benign Het
Irf5 A G 6: 29,534,001 probably null Het
Lrp2 T A 2: 69,467,169 K3149N probably benign Het
Lrrn3 A G 12: 41,454,042 V92A probably benign Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Olfr1283 T A 2: 111,369,280 I216K possibly damaging Het
Olfr466 A G 13: 65,152,700 T159A probably benign Het
Osr2 T C 15: 35,300,471 Y58H possibly damaging Het
Pop5 C T 5: 115,240,777 probably benign Het
Ror2 A G 13: 53,118,961 C211R probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sgsm2 C A 11: 74,851,766 R957L probably damaging Het
Slc16a11 A G 11: 70,215,734 probably null Het
Spag17 T A 3: 100,103,378 Y2063N probably benign Het
Usp25 A C 16: 77,115,453 K1020T probably damaging Het
Vmn1r23 T C 6: 57,926,368 I142V probably benign Het
Vmn1r235 A G 17: 21,261,592 K60E probably damaging Het
Vmn2r33 A C 7: 7,551,230 F775V probably damaging Het
Vps13b C T 15: 35,709,294 P1796S probably damaging Het
Vwa3a G A 7: 120,778,926 V480I probably benign Het
Other mutations in Map3k12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Map3k12 APN 15 102503751 missense probably damaging 1.00
IGL01713:Map3k12 APN 15 102502321 missense probably damaging 1.00
IGL01720:Map3k12 APN 15 102502186 unclassified probably benign
IGL02262:Map3k12 APN 15 102502075 missense probably damaging 1.00
IGL02670:Map3k12 APN 15 102503546 missense probably benign 0.09
IGL03004:Map3k12 APN 15 102504196 missense possibly damaging 0.96
IGL03369:Map3k12 APN 15 102502079 missense possibly damaging 0.47
react UTSW 15 102505402 missense probably damaging 1.00
R0894:Map3k12 UTSW 15 102502178 missense probably damaging 1.00
R0918:Map3k12 UTSW 15 102503852 missense probably damaging 0.99
R1547:Map3k12 UTSW 15 102503852 missense probably damaging 1.00
R1844:Map3k12 UTSW 15 102503535 missense probably damaging 1.00
R1880:Map3k12 UTSW 15 102502064 critical splice donor site probably null
R2292:Map3k12 UTSW 15 102500139 missense probably damaging 0.96
R4397:Map3k12 UTSW 15 102501259 missense probably benign 0.44
R4406:Map3k12 UTSW 15 102505402 missense probably damaging 1.00
R4407:Map3k12 UTSW 15 102505402 missense probably damaging 1.00
R4731:Map3k12 UTSW 15 102501282 missense probably benign 0.28
R5074:Map3k12 UTSW 15 102501832 critical splice donor site probably null
R5605:Map3k12 UTSW 15 102503865 missense probably benign 0.17
R5848:Map3k12 UTSW 15 102504235 missense possibly damaging 0.66
R6232:Map3k12 UTSW 15 102503646 missense probably damaging 0.99
R6901:Map3k12 UTSW 15 102500629 missense possibly damaging 0.95
R6901:Map3k12 UTSW 15 102500630 missense possibly damaging 0.65
R6946:Map3k12 UTSW 15 102505134 missense possibly damaging 0.89
R7291:Map3k12 UTSW 15 102502166 missense probably damaging 1.00
R7874:Map3k12 UTSW 15 102500642 missense possibly damaging 0.91
R7957:Map3k12 UTSW 15 102500642 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TAGATGCTCGACTCTCAGGTG -3'
(R):5'- ACCGTGAGCTCTTGCAGTAAC -3'

Sequencing Primer
(F):5'- ACTCTCAGGTGACCCAGTG -3'
(R):5'- AGCTCTTGCAGTAACTGGCTG -3'
Posted On2015-07-07