Incidental Mutation 'R4408:Vmn1r235'
List |< first << previous [record 29 of 32] next >> last >|
ID327778
Institutional Source Beutler Lab
Gene Symbol Vmn1r235
Ensembl Gene ENSMUSG00000050102
Gene Namevomeronasal 1 receptor 235
SynonymsV1rf2
MMRRC Submission 041690-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R4408 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location21260427-21262863 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21261592 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 60 (K60E)
Ref Sequence ENSEMBL: ENSMUSP00000061689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060603]
Predicted Effect probably damaging
Transcript: ENSMUST00000060603
AA Change: K60E

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000061689
Gene: ENSMUSG00000050102
AA Change: K60E

DomainStartEndE-ValueType
Pfam:V1R 52 322 2.1e-19 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1h A G 17: 25,380,627 V1588A probably damaging Het
Card6 T A 15: 5,101,054 M287L probably damaging Het
Fam227b T A 2: 126,116,125 Y240F possibly damaging Het
Fbln1 T A 15: 85,231,556 probably null Het
Fndc5 A G 4: 129,142,529 probably null Het
Gm10799 C A 2: 104,068,064 A99S possibly damaging Het
Gm27013 A T 6: 130,677,765 S245T possibly damaging Het
Gm5592 A G 7: 41,286,448 T125A probably benign Het
Gml2 T C 15: 74,824,339 probably benign Het
Gpbp1 A T 13: 111,448,964 N149K possibly damaging Het
Gprc6a T C 10: 51,628,543 I68M probably benign Het
Hnrnpu T C 1: 178,330,803 probably benign Het
Irf5 A G 6: 29,534,001 probably null Het
Lrp2 T A 2: 69,467,169 K3149N probably benign Het
Lrrn3 A G 12: 41,454,042 V92A probably benign Het
Map3k12 T C 15: 102,505,402 T45A probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Olfr1283 T A 2: 111,369,280 I216K possibly damaging Het
Olfr466 A G 13: 65,152,700 T159A probably benign Het
Osr2 T C 15: 35,300,471 Y58H possibly damaging Het
Pop5 C T 5: 115,240,777 probably benign Het
Ror2 A G 13: 53,118,961 C211R probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sgsm2 C A 11: 74,851,766 R957L probably damaging Het
Slc16a11 A G 11: 70,215,734 probably null Het
Spag17 T A 3: 100,103,378 Y2063N probably benign Het
Usp25 A C 16: 77,115,453 K1020T probably damaging Het
Vmn1r23 T C 6: 57,926,368 I142V probably benign Het
Vmn2r33 A C 7: 7,551,230 F775V probably damaging Het
Vps13b C T 15: 35,709,294 P1796S probably damaging Het
Vwa3a G A 7: 120,778,926 V480I probably benign Het
Other mutations in Vmn1r235
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0138:Vmn1r235 UTSW 17 21262334 missense probably damaging 1.00
R0149:Vmn1r235 UTSW 17 21261995 missense probably damaging 0.99
R1780:Vmn1r235 UTSW 17 21261737 missense probably benign 0.01
R1918:Vmn1r235 UTSW 17 21262397 missense possibly damaging 0.63
R1944:Vmn1r235 UTSW 17 21261523 missense probably damaging 1.00
R2151:Vmn1r235 UTSW 17 21262366 missense probably benign 0.33
R4296:Vmn1r235 UTSW 17 21262300 missense probably damaging 1.00
R4689:Vmn1r235 UTSW 17 21262361 missense probably benign 0.34
R5006:Vmn1r235 UTSW 17 21262205 missense probably benign 0.02
R5033:Vmn1r235 UTSW 17 21262288 missense possibly damaging 0.74
R5303:Vmn1r235 UTSW 17 21262006 missense probably benign 0.05
R5512:Vmn1r235 UTSW 17 21261415 start codon destroyed probably benign 0.09
R6999:Vmn1r235 UTSW 17 21261865 missense probably benign 0.04
R7133:Vmn1r235 UTSW 17 21262030 missense probably benign 0.01
R7471:Vmn1r235 UTSW 17 21262396 missense probably benign 0.07
R7552:Vmn1r235 UTSW 17 21261451 missense probably benign 0.01
R7577:Vmn1r235 UTSW 17 21261619 missense possibly damaging 0.54
R8716:Vmn1r235 UTSW 17 21262292 missense possibly damaging 0.49
R8725:Vmn1r235 UTSW 17 21261794 missense probably damaging 1.00
R8727:Vmn1r235 UTSW 17 21261794 missense probably damaging 1.00
R8729:Vmn1r235 UTSW 17 21261613 missense probably benign 0.00
R8732:Vmn1r235 UTSW 17 21262177 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGAATTTTGTTGGGACAGAAATGC -3'
(R):5'- ATGGCCTGGAAGACACTCATC -3'

Sequencing Primer
(F):5'- AGAAATGCTGTCAGTGCCTC -3'
(R):5'- GCTGCTGCAAATACATGTACC -3'
Posted On2015-07-07