Mutagenetix > Incidental Mutation

Incidental Mutation 'R4408:Cacna1h'

327779

Institutional Source

Beutler Lab

Gene Symbol

Cacna1h

Ensembl Gene

ENSMUSG00000024112

Gene Name

calcium channel, voltage-dependent, T type, alpha 1H subunit

Synonyms

Cav3.2, alpha13.2, T-type Cav3.2

MMRRC Submission

041690-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4408 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25374285-25433783 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 25380627 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1588 (V1588A)

Ref Sequence

ENSEMBL: ENSMUSP00000123741 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078496] [ENSMUST00000159048] [ENSMUST00000159610]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000078496
AA Change: V1694A

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000077586
Gene: ENSMUSG00000024112
AA Change: V1694A

Domain	Start	End	E-Value	Type
low complexity region	16	36	N/A	INTRINSIC
Pfam:Ion_trans	138	418	8.4e-65	PFAM
low complexity region	500	511	N/A	INTRINSIC
low complexity region	515	531	N/A	INTRINSIC
low complexity region	557	568	N/A	INTRINSIC
low complexity region	708	723	N/A	INTRINSIC
Pfam:Ion_trans	824	1011	4.7e-46	PFAM
low complexity region	1130	1147	N/A	INTRINSIC
low complexity region	1248	1259	N/A	INTRINSIC
Pfam:Ion_trans	1341	1565	4.5e-56	PFAM
low complexity region	1576	1602	N/A	INTRINSIC
Pfam:Ion_trans	1656	1864	7.8e-48	PFAM
Pfam:PKD_channel	1714	1871	1.2e-10	PFAM
Blast:Tryp_SPc	1915	2077	1e-38	BLAST
low complexity region	2086	2097	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000159048
AA Change: V1588A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000123741
Gene: ENSMUSG00000024112
AA Change: V1588A

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	32	312	8e-65	PFAM
low complexity region	394	405	N/A	INTRINSIC
low complexity region	409	425	N/A	INTRINSIC
low complexity region	451	462	N/A	INTRINSIC
low complexity region	602	617	N/A	INTRINSIC
Pfam:Ion_trans	718	905	4.6e-46	PFAM
low complexity region	1024	1041	N/A	INTRINSIC
low complexity region	1142	1153	N/A	INTRINSIC
Pfam:Ion_trans	1235	1459	4.3e-56	PFAM
low complexity region	1470	1496	N/A	INTRINSIC
Pfam:PKD_channel	1524	1608	1.6e-6	PFAM
Pfam:Ion_trans	1550	1758	7.6e-48	PFAM
Pfam:PKD_channel	1609	1765	1.2e-10	PFAM
Blast:Tryp_SPc	1809	1854	9e-6	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159331

Predicted Effect

possibly damaging
Transcript: ENSMUST00000159610
AA Change: V1694A

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000125541
Gene: ENSMUSG00000024112
AA Change: V1694A

Domain	Start	End	E-Value	Type
low complexity region	16	36	N/A	INTRINSIC
Pfam:Ion_trans	99	430	7e-79	PFAM
low complexity region	500	511	N/A	INTRINSIC
low complexity region	515	531	N/A	INTRINSIC
low complexity region	557	568	N/A	INTRINSIC
low complexity region	708	723	N/A	INTRINSIC
Pfam:Ion_trans	789	1023	2.4e-58	PFAM
low complexity region	1130	1147	N/A	INTRINSIC
low complexity region	1248	1259	N/A	INTRINSIC
Pfam:Ion_trans	1304	1577	4.5e-65	PFAM
Pfam:Ion_trans	1621	1876	4.2e-59	PFAM
Pfam:PKD_channel	1629	1715	9.3e-7	PFAM
Pfam:PKD_channel	1713	1871	2.2e-11	PFAM
Blast:Tryp_SPc	1915	2077	1e-38	BLAST
low complexity region	2086	2097	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000161035
AA Change: V8A

SMART Domains

Protein: ENSMUSP00000123906
Gene: ENSMUSG00000024112
AA Change: V8A

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	1	73	2.1e-9	PFAM
Pfam:Ion_trans	72	170	2.8e-17	PFAM
Blast:Tryp_SPc	209	291	3e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000161658

Meta Mutation Damage Score

0.8729

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.6%

Validation Efficiency

97% (35/36)

MGI Phenotype

FUNCTION: Voltage-dependent Ca(2+) channels mediate the entry of Ca(2+) ions into excitable cells and are involved in a variety of Ca(2+)-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. The protein encoded by this gene is an integral membrane protein that belongs to the calcium channel alpha-1 subunits family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mutation of this locus results in constitutive coronary arteriole contraction and focal myocardial fibrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Card6	T	A	15: 5,101,054	M287L	probably damaging	Het
Fam227b	T	A	2: 126,116,125	Y240F	possibly damaging	Het
Fbln1	T	A	15: 85,231,556		probably null	Het
Fndc5	A	G	4: 129,142,529		probably null	Het
Gm10799	C	A	2: 104,068,064	A99S	possibly damaging	Het
Gm27013	A	T	6: 130,677,765	S245T	possibly damaging	Het
Gm5592	A	G	7: 41,286,448	T125A	probably benign	Het
Gml2	T	C	15: 74,824,339		probably benign	Het
Gpbp1	A	T	13: 111,448,964	N149K	possibly damaging	Het
Gprc6a	T	C	10: 51,628,543	I68M	probably benign	Het
Hnrnpu	T	C	1: 178,330,803		probably benign	Het
Irf5	A	G	6: 29,534,001		probably null	Het
Lrp2	T	A	2: 69,467,169	K3149N	probably benign	Het
Lrrn3	A	G	12: 41,454,042	V92A	probably benign	Het
Map3k12	T	C	15: 102,505,402	T45A	probably damaging	Het
Myof	A	G	19: 37,922,978	S1502P	probably damaging	Het
Olfr1283	T	A	2: 111,369,280	I216K	possibly damaging	Het
Olfr466	A	G	13: 65,152,700	T159A	probably benign	Het
Osr2	T	C	15: 35,300,471	Y58H	possibly damaging	Het
Pop5	C	T	5: 115,240,777		probably benign	Het
Ror2	A	G	13: 53,118,961	C211R	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sgsm2	C	A	11: 74,851,766	R957L	probably damaging	Het
Slc16a11	A	G	11: 70,215,734		probably null	Het
Spag17	T	A	3: 100,103,378	Y2063N	probably benign	Het
Usp25	A	C	16: 77,115,453	K1020T	probably damaging	Het
Vmn1r23	T	C	6: 57,926,368	I142V	probably benign	Het
Vmn1r235	A	G	17: 21,261,592	K60E	probably damaging	Het
Vmn2r33	A	C	7: 7,551,230	F775V	probably damaging	Het
Vps13b	C	T	15: 35,709,294	P1796S	probably damaging	Het
Vwa3a	G	A	7: 120,778,926	V480I	probably benign	Het

Other mutations in Cacna1h

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00505:Cacna1h	APN	17	25381508	missense	probably damaging	1.00
IGL01412:Cacna1h	APN	17	25391950	missense	probably benign	0.24
IGL01625:Cacna1h	APN	17	25383485	missense	probably damaging	0.97
IGL01625:Cacna1h	APN	17	25385712	missense	possibly damaging	0.95
IGL01684:Cacna1h	APN	17	25388716	missense	probably damaging	1.00
IGL01862:Cacna1h	APN	17	25383483	missense	probably damaging	1.00
IGL01877:Cacna1h	APN	17	25388050	missense	probably damaging	1.00
IGL02040:Cacna1h	APN	17	25397611	missense	probably benign	0.10
IGL02190:Cacna1h	APN	17	25433026	missense	probably benign
IGL02686:Cacna1h	APN	17	25385749	missense	possibly damaging	0.80
IGL02883:Cacna1h	APN	17	25380532	missense	probably damaging	1.00
IGL02945:Cacna1h	APN	17	25388059	missense	probably damaging	1.00
IGL03025:Cacna1h	APN	17	25432894	nonsense	probably null
IGL03095:Cacna1h	APN	17	25383778	unclassified	probably benign
IGL03207:Cacna1h	APN	17	25391333	missense	probably damaging	1.00
IGL02991:Cacna1h	UTSW	17	25391312	missense	possibly damaging	0.56
IGL03097:Cacna1h	UTSW	17	25391144	missense	probably damaging	1.00
R0010:Cacna1h	UTSW	17	25380844	missense	probably damaging	1.00
R0194:Cacna1h	UTSW	17	25380924	unclassified	probably benign
R0361:Cacna1h	UTSW	17	25389422	missense	probably damaging	1.00
R0501:Cacna1h	UTSW	17	25388667	missense	probably damaging	1.00
R0558:Cacna1h	UTSW	17	25381550	missense	probably damaging	1.00
R0588:Cacna1h	UTSW	17	25387564	missense	probably damaging	1.00
R0626:Cacna1h	UTSW	17	25393546	missense	possibly damaging	0.92
R0811:Cacna1h	UTSW	17	25388628	missense	probably damaging	1.00
R0812:Cacna1h	UTSW	17	25388628	missense	probably damaging	1.00
R0964:Cacna1h	UTSW	17	25378775	unclassified	probably benign
R1351:Cacna1h	UTSW	17	25391951	missense	probably benign	0.14
R1457:Cacna1h	UTSW	17	25397620	missense	probably damaging	1.00
R1521:Cacna1h	UTSW	17	25397354	missense	possibly damaging	0.57
R1564:Cacna1h	UTSW	17	25377861	nonsense	probably null
R1611:Cacna1h	UTSW	17	25381471	missense	probably damaging	1.00
R1669:Cacna1h	UTSW	17	25383471	missense	probably damaging	1.00
R1835:Cacna1h	UTSW	17	25392076	missense	probably benign	0.01
R1858:Cacna1h	UTSW	17	25380807	missense	probably damaging	1.00
R1887:Cacna1h	UTSW	17	25376887	missense	probably benign	0.01
R2039:Cacna1h	UTSW	17	25391845	missense	probably benign	0.03
R2091:Cacna1h	UTSW	17	25432876	missense	possibly damaging	0.95
R2133:Cacna1h	UTSW	17	25383528	missense	probably damaging	1.00
R2203:Cacna1h	UTSW	17	25380260	missense	probably damaging	1.00
R2205:Cacna1h	UTSW	17	25380260	missense	probably damaging	1.00
R2206:Cacna1h	UTSW	17	25385013	missense	probably benign	0.10
R2207:Cacna1h	UTSW	17	25385013	missense	probably benign	0.10
R2224:Cacna1h	UTSW	17	25385943	missense	probably benign	0.03
R2226:Cacna1h	UTSW	17	25385943	missense	probably benign	0.03
R2261:Cacna1h	UTSW	17	25433165	missense	possibly damaging	0.91
R2361:Cacna1h	UTSW	17	25384012	missense	probably damaging	1.00
R2917:Cacna1h	UTSW	17	25395452	missense	probably damaging	0.97
R3031:Cacna1h	UTSW	17	25433134	missense	probably damaging	0.99
R3856:Cacna1h	UTSW	17	25392453	missense	probably damaging	1.00
R4230:Cacna1h	UTSW	17	25387863	missense	probably damaging	1.00
R4687:Cacna1h	UTSW	17	25393910	missense	possibly damaging	0.47
R4887:Cacna1h	UTSW	17	25377287	missense	possibly damaging	0.86
R4895:Cacna1h	UTSW	17	25389422	missense	probably damaging	0.99
R5067:Cacna1h	UTSW	17	25397808	missense	probably damaging	1.00
R5077:Cacna1h	UTSW	17	25375250	missense	probably benign	0.02
R5148:Cacna1h	UTSW	17	25387545	missense	probably damaging	1.00
R5336:Cacna1h	UTSW	17	25392231	missense	probably damaging	0.99
R5450:Cacna1h	UTSW	17	25383186	missense	probably damaging	1.00
R5616:Cacna1h	UTSW	17	25377667	missense	probably damaging	1.00
R5738:Cacna1h	UTSW	17	25387049	missense	probably damaging	0.99
R5883:Cacna1h	UTSW	17	25376922	missense	probably benign	0.00
R5954:Cacna1h	UTSW	17	25383201	missense	probably damaging	1.00
R5961:Cacna1h	UTSW	17	25377272	missense	probably benign	0.01
R6110:Cacna1h	UTSW	17	25391276	missense	probably benign	0.10
R6125:Cacna1h	UTSW	17	25385694	missense	probably benign	0.00
R6189:Cacna1h	UTSW	17	25397844	missense	probably damaging	1.00
R6216:Cacna1h	UTSW	17	25378819	missense	probably damaging	1.00
R6259:Cacna1h	UTSW	17	25397656	critical splice acceptor site	probably null
R6296:Cacna1h	UTSW	17	25383079	missense	probably damaging	1.00
R6394:Cacna1h	UTSW	17	25387481	missense	probably benign	0.32
R6695:Cacna1h	UTSW	17	25393740	missense	probably damaging	1.00
R6746:Cacna1h	UTSW	17	25381550	missense	probably damaging	1.00
R6914:Cacna1h	UTSW	17	25385039	missense	probably benign
R6942:Cacna1h	UTSW	17	25385039	missense	probably benign
R6955:Cacna1h	UTSW	17	25388056	missense	probably damaging	1.00
R7041:Cacna1h	UTSW	17	25394003	missense	probably damaging	0.98
R7120:Cacna1h	UTSW	17	25391507	missense	probably benign	0.31
R7125:Cacna1h	UTSW	17	25383536	missense	probably damaging	0.99
R7182:Cacna1h	UTSW	17	25377655	missense	probably damaging	1.00
R7270:Cacna1h	UTSW	17	25384765	missense	probably damaging	1.00
R7274:Cacna1h	UTSW	17	25378837	missense	probably damaging	1.00
R7319:Cacna1h	UTSW	17	25389461	missense	possibly damaging	0.94
R7406:Cacna1h	UTSW	17	25385626	missense	possibly damaging	0.56
R7634:Cacna1h	UTSW	17	25392109	missense	possibly damaging	0.87
R7684:Cacna1h	UTSW	17	25389372	missense	probably damaging	0.99
R7769:Cacna1h	UTSW	17	25385805	missense	probably damaging	1.00
R7856:Cacna1h	UTSW	17	25389477	missense	probably damaging	0.98
R7876:Cacna1h	UTSW	17	25375251	missense	probably benign
R7898:Cacna1h	UTSW	17	25392276	missense	probably damaging	1.00
R8038:Cacna1h	UTSW	17	25375891	missense	probably damaging	0.97
R8042:Cacna1h	UTSW	17	25392471	nonsense	probably null
R8139:Cacna1h	UTSW	17	25383723	missense	probably damaging	1.00
R8391:Cacna1h	UTSW	17	25377230	missense	probably benign	0.00
R8795:Cacna1h	UTSW	17	25393564	missense	probably damaging	1.00
R9227:Cacna1h	UTSW	17	25380882	missense	probably damaging	1.00
R9230:Cacna1h	UTSW	17	25380882	missense	probably damaging	1.00
R9236:Cacna1h	UTSW	17	25381450	missense	probably damaging	1.00
R9360:Cacna1h	UTSW	17	25375362	missense	probably benign	0.00
R9476:Cacna1h	UTSW	17	25392550	missense	probably damaging	1.00
R9567:Cacna1h	UTSW	17	25393513	missense	probably damaging	1.00
V1662:Cacna1h	UTSW	17	25377309	missense	possibly damaging	0.68
Z1176:Cacna1h	UTSW	17	25391250	missense	probably benign
Z1177:Cacna1h	UTSW	17	25375892	missense	probably damaging	1.00
Z1177:Cacna1h	UTSW	17	25391378	missense	probably damaging	0.99
Z1177:Cacna1h	UTSW	17	25393584	missense	probably benign	0.15

Predicted Primers

PCR Primer
(F):5'- CTATAGCCCATCCTACCAGGTCTG -3'
(R):5'- ACTGAAGCTGGTGGCCTTTG -3'

Sequencing Primer
(F):5'- TCTGGGGCCTACCGACAG -3'
(R):5'- CTTCAAGGACAGGTGTGTGATCAC -3'

Posted On

2015-07-07