Incidental Mutation 'R0045:Wapl'
ID 32779
Institutional Source Beutler Lab
Gene Symbol Wapl
Ensembl Gene ENSMUSG00000041408
Gene Name WAPL cohesin release factor
Synonyms A530089A20Rik, Wapal
MMRRC Submission 038339-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0045 (G1)
Quality Score 201
Status Validated
Chromosome 14
Chromosomal Location 34395885-34469940 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34455751 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 176 (I176V)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048263] [ENSMUST00000090027] [ENSMUST00000169910]
AlphaFold Q65Z40
Predicted Effect probably benign
Transcript: ENSMUST00000048263
AA Change: I892V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000040232
Gene: ENSMUSG00000041408
AA Change: I892V

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 645 1009 6.5e-153 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090027
AA Change: I886V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408
AA Change: I886V

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 639 1003 2.6e-153 PFAM
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111895
Predicted Effect probably benign
Transcript: ENSMUST00000151285
AA Change: I176V

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000117282
Gene: ENSMUSG00000041408
AA Change: I176V

DomainStartEndE-ValueType
Pfam:WAPL 1 281 1.1e-78 PFAM
coiled coil region 329 351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169910
AA Change: I892V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130547
Gene: ENSMUSG00000041408
AA Change: I892V

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 647 1008 3.5e-120 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174559
SMART Domains Protein: ENSMUSP00000133779
Gene: ENSMUSG00000041408

DomainStartEndE-ValueType
Pfam:WAPL 1 55 8.6e-22 PFAM
low complexity region 64 79 N/A INTRINSIC
coiled coil region 119 141 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: Studies suggest that the protein encoded by this gene is important for the release of cohesin from chromatin. This gene product is thought to be essential for development, and reduced expression of this gene in cells causes defects in chromatin structure. High levels of expression of the human ortholog of this gene are observed in cervical cancers, and expression of the human ortholog of this gene in mice results in tumor formation. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,220,148 (GRCm39) N299S probably damaging Het
Abi3 A G 11: 95,723,541 (GRCm39) *368R probably null Het
Agbl1 T C 7: 76,348,588 (GRCm39) probably null Het
Ap3b2 T C 7: 81,115,941 (GRCm39) D650G possibly damaging Het
Arhgap30 A G 1: 171,235,998 (GRCm39) S791G probably benign Het
Arvcf T A 16: 18,222,208 (GRCm39) L722Q probably benign Het
Ascc3 C T 10: 50,594,498 (GRCm39) R1198* probably null Het
Atf2 G T 2: 73,660,200 (GRCm39) T189N probably benign Het
Atf7ip A G 6: 136,536,814 (GRCm39) K16E probably damaging Het
Atg9b G T 5: 24,592,396 (GRCm39) Q621K probably damaging Het
Atp12a G A 14: 56,610,330 (GRCm39) E234K probably damaging Het
C8a T C 4: 104,684,012 (GRCm39) K368E probably benign Het
Ccdc168 T C 1: 44,096,365 (GRCm39) K1578E probably benign Het
Cdh23 T C 10: 60,366,757 (GRCm39) Y241C probably damaging Het
Cdon G A 9: 35,398,103 (GRCm39) S940N probably benign Het
Cds2 G T 2: 132,147,075 (GRCm39) G402V possibly damaging Het
Cog6 T C 3: 52,900,171 (GRCm39) probably null Het
Commd10 T C 18: 47,100,903 (GRCm39) S114P possibly damaging Het
Dram2 T C 3: 106,478,133 (GRCm39) V155A possibly damaging Het
Egr2 T A 10: 67,376,310 (GRCm39) V252E probably benign Het
Exoc3l C T 8: 106,020,317 (GRCm39) V203M probably damaging Het
Fsip1 C A 2: 118,078,773 (GRCm39) probably null Het
Gm10840 C A 11: 106,051,926 (GRCm39) probably benign Het
Gpr37l1 A G 1: 135,088,883 (GRCm39) L394P probably damaging Het
Gsap T C 5: 21,431,830 (GRCm39) M243T possibly damaging Het
Hsd3b5 T A 3: 98,526,460 (GRCm39) I329F probably benign Het
Htra1 T A 7: 130,563,262 (GRCm39) S164R probably damaging Het
Il17b G A 18: 61,823,315 (GRCm39) V50M probably damaging Het
Itga4 A T 2: 79,131,375 (GRCm39) Y581F probably damaging Het
Jmjd8 A G 17: 26,048,255 (GRCm39) E92G probably damaging Het
Kcnq4 T A 4: 120,555,152 (GRCm39) D677V probably damaging Het
Klhl42 A G 6: 146,993,666 (GRCm39) T213A probably benign Het
Lcn5 T C 2: 25,550,710 (GRCm39) S133P probably damaging Het
Liph T C 16: 21,786,803 (GRCm39) Y271C probably damaging Het
Lpcat3 T C 6: 124,678,437 (GRCm39) I228T probably benign Het
Lrrd1 A G 5: 3,916,418 (GRCm39) K812E possibly damaging Het
Ltbp2 T C 12: 84,860,062 (GRCm39) T631A probably damaging Het
Ltbp2 G A 12: 84,856,361 (GRCm39) T701I probably damaging Het
Mavs G A 2: 131,080,751 (GRCm39) R13Q probably damaging Het
Mtor C G 4: 148,549,406 (GRCm39) H597D probably benign Het
Muc5b T A 7: 141,410,555 (GRCm39) H1309Q unknown Het
Myl3 A C 9: 110,596,997 (GRCm39) D119A probably damaging Het
Nnat A T 2: 157,402,408 (GRCm39) probably benign Het
Or14c40 T C 7: 86,313,548 (GRCm39) L226S possibly damaging Het
Or2ag19 T A 7: 106,444,596 (GRCm39) Y259* probably null Het
Or5h17 G A 16: 58,820,854 (GRCm39) D269N probably benign Het
Or7e175 A T 9: 20,048,487 (GRCm39) Q25L probably benign Het
Pclo C T 5: 14,589,485 (GRCm39) A595V unknown Het
Pcsk6 T A 7: 65,612,676 (GRCm39) C315S probably damaging Het
Pkd2 T A 5: 104,603,671 (GRCm39) probably benign Het
Ppp2r3c T A 12: 55,340,606 (GRCm39) I155F probably damaging Het
Rapgef4 A G 2: 72,029,122 (GRCm39) H398R possibly damaging Het
Ripor2 A G 13: 24,878,209 (GRCm39) D328G probably damaging Het
Rpgrip1 A T 14: 52,378,601 (GRCm39) T509S possibly damaging Het
Sh3pxd2a A G 19: 47,255,622 (GRCm39) I1032T probably damaging Het
Slc25a13 A T 6: 6,109,277 (GRCm39) S362T probably benign Het
Stk35 A T 2: 129,642,488 (GRCm39) R10* probably null Het
Tal1 A G 4: 114,925,762 (GRCm39) D277G probably damaging Het
Tecta G A 9: 42,286,487 (GRCm39) T723I probably damaging Het
Trp53bp1 A C 2: 121,034,978 (GRCm39) V103G probably benign Het
Trpv4 A G 5: 114,774,518 (GRCm39) S189P probably benign Het
Ttll5 T G 12: 85,926,133 (GRCm39) probably benign Het
Usp8 A G 2: 126,584,143 (GRCm39) T451A probably benign Het
Vac14 G A 8: 111,363,584 (GRCm39) D340N probably benign Het
Vars1 C A 17: 35,217,042 (GRCm39) A471S probably benign Het
Vars1 A T 17: 35,229,595 (GRCm39) H404L probably damaging Het
Vmn2r70 T C 7: 85,215,252 (GRCm39) N94S probably damaging Het
Vpreb1b T C 16: 17,798,631 (GRCm39) L39P probably damaging Het
Vps13a A T 19: 16,618,174 (GRCm39) L693* probably null Het
Wdr31 G T 4: 62,382,270 (GRCm39) L4I possibly damaging Het
Other mutations in Wapl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Wapl APN 14 34,414,593 (GRCm39) missense probably benign 0.00
IGL00539:Wapl APN 14 34,416,965 (GRCm39) missense probably damaging 1.00
IGL00846:Wapl APN 14 34,414,701 (GRCm39) splice site probably benign
IGL01070:Wapl APN 14 34,467,579 (GRCm39) unclassified probably benign
IGL01516:Wapl APN 14 34,414,038 (GRCm39) missense probably damaging 1.00
IGL02021:Wapl APN 14 34,444,293 (GRCm39) missense probably benign
IGL02209:Wapl APN 14 34,399,218 (GRCm39) missense possibly damaging 0.46
IGL02309:Wapl APN 14 34,466,820 (GRCm39) missense probably damaging 0.98
IGL02471:Wapl APN 14 34,413,877 (GRCm39) missense possibly damaging 0.68
IGL02965:Wapl APN 14 34,461,181 (GRCm39) intron probably benign
IGL03076:Wapl APN 14 34,414,046 (GRCm39) missense probably benign 0.26
IGL03197:Wapl APN 14 34,467,588 (GRCm39) missense possibly damaging 0.77
Mcclintock UTSW 14 34,452,619 (GRCm39) critical splice donor site probably null
Tatum UTSW 14 34,451,152 (GRCm39) missense probably damaging 1.00
R0278:Wapl UTSW 14 34,414,569 (GRCm39) missense possibly damaging 0.68
R0335:Wapl UTSW 14 34,414,281 (GRCm39) missense probably damaging 0.99
R1018:Wapl UTSW 14 34,413,863 (GRCm39) missense possibly damaging 0.91
R1295:Wapl UTSW 14 34,446,726 (GRCm39) missense probably damaging 1.00
R1553:Wapl UTSW 14 34,451,147 (GRCm39) missense probably damaging 1.00
R1868:Wapl UTSW 14 34,414,415 (GRCm39) missense probably benign 0.00
R1909:Wapl UTSW 14 34,413,869 (GRCm39) missense probably damaging 1.00
R2698:Wapl UTSW 14 34,413,734 (GRCm39) missense probably benign
R2990:Wapl UTSW 14 34,458,665 (GRCm39) missense probably damaging 0.98
R3121:Wapl UTSW 14 34,451,172 (GRCm39) missense possibly damaging 0.93
R3122:Wapl UTSW 14 34,451,172 (GRCm39) missense possibly damaging 0.93
R3147:Wapl UTSW 14 34,447,106 (GRCm39) missense probably damaging 1.00
R3732:Wapl UTSW 14 34,458,721 (GRCm39) missense probably damaging 0.99
R3732:Wapl UTSW 14 34,458,721 (GRCm39) missense probably damaging 0.99
R3733:Wapl UTSW 14 34,458,721 (GRCm39) missense probably damaging 0.99
R3878:Wapl UTSW 14 34,414,104 (GRCm39) missense probably damaging 1.00
R4034:Wapl UTSW 14 34,459,871 (GRCm39) missense possibly damaging 0.92
R4934:Wapl UTSW 14 34,414,052 (GRCm39) missense probably benign 0.11
R5079:Wapl UTSW 14 34,446,714 (GRCm39) missense probably damaging 1.00
R5104:Wapl UTSW 14 34,414,016 (GRCm39) nonsense probably null
R5113:Wapl UTSW 14 34,446,711 (GRCm39) missense probably damaging 1.00
R5121:Wapl UTSW 14 34,399,119 (GRCm39) missense probably benign 0.01
R5222:Wapl UTSW 14 34,458,642 (GRCm39) nonsense probably null
R5299:Wapl UTSW 14 34,455,765 (GRCm39) critical splice donor site probably null
R5387:Wapl UTSW 14 34,399,252 (GRCm39) missense probably benign 0.00
R5541:Wapl UTSW 14 34,452,619 (GRCm39) critical splice donor site probably null
R5618:Wapl UTSW 14 34,413,863 (GRCm39) missense possibly damaging 0.91
R5802:Wapl UTSW 14 34,414,277 (GRCm39) missense probably damaging 1.00
R6029:Wapl UTSW 14 34,461,204 (GRCm39) missense possibly damaging 0.94
R6292:Wapl UTSW 14 34,451,152 (GRCm39) missense probably damaging 1.00
R6482:Wapl UTSW 14 34,414,649 (GRCm39) missense probably benign 0.01
R6487:Wapl UTSW 14 34,414,249 (GRCm39) missense probably damaging 1.00
R6925:Wapl UTSW 14 34,399,320 (GRCm39) missense probably benign 0.31
R6937:Wapl UTSW 14 34,444,311 (GRCm39) missense probably benign 0.01
R7080:Wapl UTSW 14 34,414,313 (GRCm39) missense probably benign 0.03
R7203:Wapl UTSW 14 34,458,648 (GRCm39) missense probably benign
R7944:Wapl UTSW 14 34,399,105 (GRCm39) missense probably benign 0.00
R7945:Wapl UTSW 14 34,399,105 (GRCm39) missense probably benign 0.00
R7969:Wapl UTSW 14 34,452,604 (GRCm39) missense probably damaging 1.00
R8038:Wapl UTSW 14 34,413,639 (GRCm39) missense probably benign
R8053:Wapl UTSW 14 34,414,278 (GRCm39) missense probably damaging 1.00
R8688:Wapl UTSW 14 34,414,549 (GRCm39) missense possibly damaging 0.94
R8864:Wapl UTSW 14 34,414,159 (GRCm39) missense probably benign 0.03
R8988:Wapl UTSW 14 34,451,139 (GRCm39) missense probably damaging 1.00
R9072:Wapl UTSW 14 34,399,417 (GRCm39) missense possibly damaging 0.81
R9197:Wapl UTSW 14 34,444,244 (GRCm39) missense probably damaging 1.00
R9259:Wapl UTSW 14 34,463,052 (GRCm39) missense probably benign 0.00
R9545:Wapl UTSW 14 34,399,050 (GRCm39) missense probably damaging 1.00
R9613:Wapl UTSW 14 34,453,520 (GRCm39) missense probably benign 0.29
R9624:Wapl UTSW 14 34,414,063 (GRCm39) missense possibly damaging 0.89
Z1177:Wapl UTSW 14 34,467,647 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- tgtgCCCTTAGATGACAAGATCTGTTTC -3'
(R):5'- GTGGCAGCACTAGCCTAATTGTGAA -3'

Sequencing Primer
(F):5'- ATATCCATCCCTTCTAGGT -3'
(R):5'- CTTGTAACAAGTCATTTGTCCTGG -3'
Posted On 2013-05-09