Incidental Mutation 'R4409:Car2'
ID327791
Institutional Source Beutler Lab
Gene Symbol Car2
Ensembl Gene ENSMUSG00000027562
Gene Namecarbonic anhydrase 2
SynonymsCar-2, Ltw-5, CAII, Lvtw-5, CA II
MMRRC Submission 041691-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.424) question?
Stock #R4409 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location14886273-14900770 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 14895102 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 105 (S105T)
Ref Sequence ENSEMBL: ENSMUSP00000141876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029078] [ENSMUST00000192609]
Predicted Effect probably damaging
Transcript: ENSMUST00000029078
AA Change: S105T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029078
Gene: ENSMUSG00000027562
AA Change: S105T

DomainStartEndE-ValueType
Carb_anhydrase 5 259 1.2e-136 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000192609
AA Change: S105T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141876
Gene: ENSMUSG00000027562
AA Change: S105T

DomainStartEndE-ValueType
Carb_anhydrase 5 115 8.2e-13 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of several isozymes of carbonic anhydrase, which catalyzes reversible hydration of carbon dioxide. Defects in this enzyme are associated with osteopetrosis and renal tubular acidosis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygous mutant mice are growth retarded, display renal tubular acidosis, but mutants have not been recovered that display osteopetrosis as found in human CA-II deficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A C 12: 118,872,922 L1085V probably damaging Het
Adgrf5 T C 17: 43,441,847 V560A probably damaging Het
Ambp C A 4: 63,152,647 S65I probably damaging Het
Ash1l A G 3: 89,007,199 D1712G probably damaging Het
Capn7 T C 14: 31,355,339 L338P probably damaging Het
Casr A G 16: 36,500,341 C482R probably benign Het
Ccdc18 C T 5: 108,220,842 Q1277* probably null Het
Clca1 A G 3: 145,006,027 F736L probably damaging Het
Col6a1 T C 10: 76,721,500 H206R probably benign Het
Crybg1 C T 10: 43,998,758 A785T possibly damaging Het
Cyp2c68 T A 19: 39,739,452 E85D probably damaging Het
Dnah9 T C 11: 66,085,477 S1249G possibly damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fbxw24 A T 9: 109,608,188 D210E probably damaging Het
Fcgr1 T C 3: 96,284,577 Y305C probably benign Het
Gm10226 G T 17: 21,691,969 C37F possibly damaging Het
Gm13178 A T 4: 144,721,302 S35T possibly damaging Het
Gm8909 T A 17: 36,165,850 H244L possibly damaging Het
Greb1l A G 18: 10,503,182 Y411C possibly damaging Het
Grin1 T C 2: 25,310,439 N224D possibly damaging Het
Ighmbp2 C T 19: 3,271,536 V408I probably benign Het
Il1rap G A 16: 26,712,265 probably null Het
Iqcg A G 16: 33,045,518 probably null Het
Klhdc3 C T 17: 46,677,018 G249E probably damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Macrod2 T G 2: 140,418,857 H68Q possibly damaging Het
Morn4 T C 19: 42,078,547 T2A possibly damaging Het
Msc G C 1: 14,755,678 P24R probably damaging Het
Msh5 T C 17: 35,039,250 D300G probably damaging Het
Myo10 A G 15: 25,807,869 Y1859C probably damaging Het
Nacc1 A G 8: 84,673,044 *515Q probably null Het
Olfr1378 T A 11: 50,969,396 I126N probably damaging Het
Olfr722 T A 14: 49,895,773 T10S probably benign Het
Olfr998 T C 2: 85,590,930 L130S probably damaging Het
Oxgr1 C T 14: 120,022,160 V212M possibly damaging Het
P3h2 G C 16: 26,105,290 R132G possibly damaging Het
Pcdha9 T A 18: 36,999,145 H422Q probably benign Het
Pcdhga12 A G 18: 37,768,085 T657A probably damaging Het
Pcx A G 19: 4,610,003 K442R possibly damaging Het
Pkd2 T C 5: 104,466,884 silent Het
Plg T G 17: 12,390,263 C152G probably damaging Het
Plk4 A G 3: 40,806,549 E438G probably damaging Het
Ryr3 A G 2: 112,730,308 L3016P probably damaging Het
Sdccag8 T G 1: 176,868,366 probably null Het
Slc24a1 A T 9: 64,948,224 M467K probably benign Het
Sorl1 T G 9: 42,035,448 I856L probably damaging Het
Spag7 T C 11: 70,664,862 D83G probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmprss11b T C 5: 86,664,278 N170S probably benign Het
Tnfrsf1b G A 4: 145,224,285 Q253* probably null Het
Trim12a G A 7: 104,306,994 A113V probably benign Het
Ttn A G 2: 76,897,643 probably benign Het
Vmn1r213 A C 13: 23,011,423 probably benign Het
Vmn1r54 C A 6: 90,269,882 Y259* probably null Het
Vmn1r55 A G 7: 5,147,076 V116A probably benign Het
Vmn2r120 T C 17: 57,509,477 N626S probably damaging Het
Vmn2r58 A G 7: 41,872,627 F15S possibly damaging Het
Vmn2r73 A T 7: 85,871,560 V400E probably damaging Het
Zbtb39 A G 10: 127,742,827 I423M possibly damaging Het
Zfp352 A G 4: 90,225,164 N514D probably benign Het
Zfp451 A T 1: 33,777,413 H485Q probably damaging Het
Other mutations in Car2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01759:Car2 APN 3 14895628 critical splice donor site probably null
IGL02618:Car2 APN 3 14897972 missense probably benign 0.00
IGL03247:Car2 APN 3 14887939 missense probably damaging 1.00
IGL03342:Car2 APN 3 14895569 missense probably benign 0.21
R0257:Car2 UTSW 3 14899977 missense probably benign 0.00
R1260:Car2 UTSW 3 14895580 missense probably damaging 1.00
R4527:Car2 UTSW 3 14898005 missense probably damaging 1.00
R4681:Car2 UTSW 3 14895564 nonsense probably null
R5677:Car2 UTSW 3 14898055 missense possibly damaging 0.92
R6343:Car2 UTSW 3 14887965 missense probably damaging 1.00
R6530:Car2 UTSW 3 14896731 missense probably benign 0.05
R6786:Car2 UTSW 3 14886650 start gained probably benign
R7010:Car2 UTSW 3 14900053 missense possibly damaging 0.82
R7682:Car2 UTSW 3 14887965 missense probably damaging 1.00
R7805:Car2 UTSW 3 14900070 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACATCTGTTGTCCAGCAGTTAG -3'
(R):5'- CTTCAAGAGCAATGCTAAGACAAGG -3'

Sequencing Primer
(F):5'- CAGTTAGCACATTGGAAAGTAAAAC -3'
(R):5'- GGACATGTAGAATTTTTAGAAAAGGC -3'
Posted On2015-07-07