Incidental Mutation 'R4409:Tnfrsf1b'
ID327799
Institutional Source Beutler Lab
Gene Symbol Tnfrsf1b
Ensembl Gene ENSMUSG00000028599
Gene Nametumor necrosis factor receptor superfamily, member 1b
SynonymsTNFalpha-R2, TNFBR, CD120b, TNFR80, TNF-R-II, TNF-R75, p75 TNFR, Tnfr2, p75, TNF-R2, TNFRII, TNF-alphaR2
MMRRC Submission 041691-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.378) question?
Stock #R4409 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location145213463-145246870 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 145224285 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 253 (Q253*)
Ref Sequence ENSEMBL: ENSMUSP00000030336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030336] [ENSMUST00000143055]
Predicted Effect probably null
Transcript: ENSMUST00000030336
AA Change: Q253*
SMART Domains Protein: ENSMUSP00000030336
Gene: ENSMUSG00000028599
AA Change: Q253*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TNFR 40 76 2.15e-9 SMART
TNFR 79 119 2.19e-10 SMART
TNFR 121 163 7.27e-7 SMART
TNFR 166 202 2.22e-2 SMART
transmembrane domain 263 285 N/A INTRINSIC
low complexity region 324 338 N/A INTRINSIC
low complexity region 363 378 N/A INTRINSIC
low complexity region 390 405 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143055
SMART Domains Protein: ENSMUSP00000115702
Gene: ENSMUSG00000028599

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This protein and TNF-receptor 1 form a heterocomplex that mediates the recruitment of two anti-apoptotic proteins, c-IAP1 and c-IAP2, which possess E3 ubiquitin ligase activity. The function of IAPs in TNF-receptor signalling is unknown, however, c-IAP1 is thought to potentiate TNF-induced apoptosis by the ubiquitination and degradation of TNF-receptor-associated factor 2, which mediates anti-apoptotic signals. Knockout studies in mice also suggest a role of this protein in protecting neurons from apoptosis by stimulating antioxidative pathways. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit altered inflammatory responses in a variety of experimental conditions, impaired recovery from spinal cord injury, enhanced ischemia-reperfusion-induced retinal damage, and resistance to cerebral malaria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A C 12: 118,872,922 L1085V probably damaging Het
Adgrf5 T C 17: 43,441,847 V560A probably damaging Het
Ambp C A 4: 63,152,647 S65I probably damaging Het
Ash1l A G 3: 89,007,199 D1712G probably damaging Het
Capn7 T C 14: 31,355,339 L338P probably damaging Het
Car2 T A 3: 14,895,102 S105T probably damaging Het
Casr A G 16: 36,500,341 C482R probably benign Het
Ccdc18 C T 5: 108,220,842 Q1277* probably null Het
Clca1 A G 3: 145,006,027 F736L probably damaging Het
Col6a1 T C 10: 76,721,500 H206R probably benign Het
Crybg1 C T 10: 43,998,758 A785T possibly damaging Het
Cyp2c68 T A 19: 39,739,452 E85D probably damaging Het
Dnah9 T C 11: 66,085,477 S1249G possibly damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fbxw24 A T 9: 109,608,188 D210E probably damaging Het
Fcgr1 T C 3: 96,284,577 Y305C probably benign Het
Gm10226 G T 17: 21,691,969 C37F possibly damaging Het
Gm13178 A T 4: 144,721,302 S35T possibly damaging Het
Gm8909 T A 17: 36,165,850 H244L possibly damaging Het
Greb1l A G 18: 10,503,182 Y411C possibly damaging Het
Grin1 T C 2: 25,310,439 N224D possibly damaging Het
Ighmbp2 C T 19: 3,271,536 V408I probably benign Het
Il1rap G A 16: 26,712,265 probably null Het
Iqcg A G 16: 33,045,518 probably null Het
Klhdc3 C T 17: 46,677,018 G249E probably damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Macrod2 T G 2: 140,418,857 H68Q possibly damaging Het
Morn4 T C 19: 42,078,547 T2A possibly damaging Het
Msc G C 1: 14,755,678 P24R probably damaging Het
Msh5 T C 17: 35,039,250 D300G probably damaging Het
Myo10 A G 15: 25,807,869 Y1859C probably damaging Het
Nacc1 A G 8: 84,673,044 *515Q probably null Het
Olfr1378 T A 11: 50,969,396 I126N probably damaging Het
Olfr722 T A 14: 49,895,773 T10S probably benign Het
Olfr998 T C 2: 85,590,930 L130S probably damaging Het
Oxgr1 C T 14: 120,022,160 V212M possibly damaging Het
P3h2 G C 16: 26,105,290 R132G possibly damaging Het
Pcdha9 T A 18: 36,999,145 H422Q probably benign Het
Pcdhga12 A G 18: 37,768,085 T657A probably damaging Het
Pcx A G 19: 4,610,003 K442R possibly damaging Het
Pkd2 T C 5: 104,466,884 silent Het
Plg T G 17: 12,390,263 C152G probably damaging Het
Plk4 A G 3: 40,806,549 E438G probably damaging Het
Ryr3 A G 2: 112,730,308 L3016P probably damaging Het
Sdccag8 T G 1: 176,868,366 probably null Het
Slc24a1 A T 9: 64,948,224 M467K probably benign Het
Sorl1 T G 9: 42,035,448 I856L probably damaging Het
Spag7 T C 11: 70,664,862 D83G probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmprss11b T C 5: 86,664,278 N170S probably benign Het
Trim12a G A 7: 104,306,994 A113V probably benign Het
Ttn A G 2: 76,897,643 probably benign Het
Vmn1r213 A C 13: 23,011,423 probably benign Het
Vmn1r54 C A 6: 90,269,882 Y259* probably null Het
Vmn1r55 A G 7: 5,147,076 V116A probably benign Het
Vmn2r120 T C 17: 57,509,477 N626S probably damaging Het
Vmn2r58 A G 7: 41,872,627 F15S possibly damaging Het
Vmn2r73 A T 7: 85,871,560 V400E probably damaging Het
Zbtb39 A G 10: 127,742,827 I423M possibly damaging Het
Zfp352 A G 4: 90,225,164 N514D probably benign Het
Zfp451 A T 1: 33,777,413 H485Q probably damaging Het
Other mutations in Tnfrsf1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Tnfrsf1b APN 4 145225416 missense probably damaging 1.00
IGL01716:Tnfrsf1b APN 4 145215923 missense probably damaging 0.97
IGL01974:Tnfrsf1b APN 4 145215851 missense probably damaging 1.00
IGL02631:Tnfrsf1b APN 4 145224828 missense probably damaging 1.00
R0011:Tnfrsf1b UTSW 4 145222966 missense possibly damaging 0.77
R0135:Tnfrsf1b UTSW 4 145229046 missense probably benign 0.15
R0194:Tnfrsf1b UTSW 4 145224812 missense probably benign 0.04
R0761:Tnfrsf1b UTSW 4 145216100 missense possibly damaging 0.95
R1124:Tnfrsf1b UTSW 4 145224356 missense probably benign 0.23
R1696:Tnfrsf1b UTSW 4 145227474 missense probably benign
R3692:Tnfrsf1b UTSW 4 145227522 missense probably benign 0.01
R4248:Tnfrsf1b UTSW 4 145215965 missense probably benign 0.01
R4957:Tnfrsf1b UTSW 4 145246757 missense probably damaging 0.99
R4957:Tnfrsf1b UTSW 4 145246758 missense possibly damaging 0.90
R5180:Tnfrsf1b UTSW 4 145227497 missense probably damaging 1.00
R5425:Tnfrsf1b UTSW 4 145229108 critical splice acceptor site probably null
R6163:Tnfrsf1b UTSW 4 145219907 missense probably benign 0.24
R7055:Tnfrsf1b UTSW 4 145224887 missense probably damaging 1.00
R7891:Tnfrsf1b UTSW 4 145229090 missense probably damaging 1.00
R7974:Tnfrsf1b UTSW 4 145229090 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTACCAATGGGCTACAGC -3'
(R):5'- CTATTCCCGGAAATGCAAGC -3'

Sequencing Primer
(F):5'- GTCTGACTAAGTTGCCCAGATTGAC -3'
(R):5'- CCCGGAAATGCAAGCACAGATG -3'
Posted On2015-07-07