Incidental Mutation 'R4409:Crybg1'
ID327812
Institutional Source Beutler Lab
Gene Symbol Crybg1
Ensembl Gene ENSMUSG00000019866
Gene Namecrystallin beta-gamma domain containing 1
SynonymsAim1
MMRRC Submission 041691-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4409 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location43950636-44148853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 43998758 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 785 (A785T)
Ref Sequence ENSEMBL: ENSMUSP00000143429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020017] [ENSMUST00000200401]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020017
AA Change: A411T

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000020017
Gene: ENSMUSG00000019866
AA Change: A411T

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 114 121 N/A INTRINSIC
low complexity region 176 192 N/A INTRINSIC
low complexity region 436 453 N/A INTRINSIC
low complexity region 507 518 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 837 857 N/A INTRINSIC
XTALbg 995 1078 8.57e-9 SMART
XTALbg 1094 1175 4.73e-20 SMART
XTALbg 1189 1282 1.23e-32 SMART
XTALbg 1290 1373 9.3e-28 SMART
XTALbg 1386 1465 1.66e-24 SMART
XTALbg 1473 1553 5.29e-32 SMART
RICIN 1556 1689 5.86e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000200401
AA Change: A785T

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143429
Gene: ENSMUSG00000019866
AA Change: A785T

DomainStartEndE-ValueType
low complexity region 377 390 N/A INTRINSIC
low complexity region 488 495 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
low complexity region 810 827 N/A INTRINSIC
low complexity region 881 892 N/A INTRINSIC
low complexity region 918 931 N/A INTRINSIC
low complexity region 1211 1231 N/A INTRINSIC
XTALbg 1369 1452 5.4e-11 SMART
XTALbg 1468 1549 2.9e-22 SMART
XTALbg 1563 1656 7.9e-35 SMART
XTALbg 1664 1747 6e-30 SMART
XTALbg 1760 1839 1.1e-26 SMART
XTALbg 1847 1927 3.3e-34 SMART
RICIN 1930 2063 3.3e-17 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A C 12: 118,872,922 L1085V probably damaging Het
Adgrf5 T C 17: 43,441,847 V560A probably damaging Het
Ambp C A 4: 63,152,647 S65I probably damaging Het
Ash1l A G 3: 89,007,199 D1712G probably damaging Het
Capn7 T C 14: 31,355,339 L338P probably damaging Het
Car2 T A 3: 14,895,102 S105T probably damaging Het
Casr A G 16: 36,500,341 C482R probably benign Het
Ccdc18 C T 5: 108,220,842 Q1277* probably null Het
Clca1 A G 3: 145,006,027 F736L probably damaging Het
Col6a1 T C 10: 76,721,500 H206R probably benign Het
Cyp2c68 T A 19: 39,739,452 E85D probably damaging Het
Dnah9 T C 11: 66,085,477 S1249G possibly damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fbxw24 A T 9: 109,608,188 D210E probably damaging Het
Fcgr1 T C 3: 96,284,577 Y305C probably benign Het
Gm10226 G T 17: 21,691,969 C37F possibly damaging Het
Gm13178 A T 4: 144,721,302 S35T possibly damaging Het
Gm8909 T A 17: 36,165,850 H244L possibly damaging Het
Greb1l A G 18: 10,503,182 Y411C possibly damaging Het
Grin1 T C 2: 25,310,439 N224D possibly damaging Het
Ighmbp2 C T 19: 3,271,536 V408I probably benign Het
Il1rap G A 16: 26,712,265 probably null Het
Iqcg A G 16: 33,045,518 probably null Het
Klhdc3 C T 17: 46,677,018 G249E probably damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Macrod2 T G 2: 140,418,857 H68Q possibly damaging Het
Morn4 T C 19: 42,078,547 T2A possibly damaging Het
Msc G C 1: 14,755,678 P24R probably damaging Het
Msh5 T C 17: 35,039,250 D300G probably damaging Het
Myo10 A G 15: 25,807,869 Y1859C probably damaging Het
Nacc1 A G 8: 84,673,044 *515Q probably null Het
Olfr1378 T A 11: 50,969,396 I126N probably damaging Het
Olfr722 T A 14: 49,895,773 T10S probably benign Het
Olfr998 T C 2: 85,590,930 L130S probably damaging Het
Oxgr1 C T 14: 120,022,160 V212M possibly damaging Het
P3h2 G C 16: 26,105,290 R132G possibly damaging Het
Pcdha9 T A 18: 36,999,145 H422Q probably benign Het
Pcdhga12 A G 18: 37,768,085 T657A probably damaging Het
Pcx A G 19: 4,610,003 K442R possibly damaging Het
Pkd2 T C 5: 104,466,884 silent Het
Plg T G 17: 12,390,263 C152G probably damaging Het
Plk4 A G 3: 40,806,549 E438G probably damaging Het
Ryr3 A G 2: 112,730,308 L3016P probably damaging Het
Sdccag8 T G 1: 176,868,366 probably null Het
Slc24a1 A T 9: 64,948,224 M467K probably benign Het
Sorl1 T G 9: 42,035,448 I856L probably damaging Het
Spag7 T C 11: 70,664,862 D83G probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmprss11b T C 5: 86,664,278 N170S probably benign Het
Tnfrsf1b G A 4: 145,224,285 Q253* probably null Het
Trim12a G A 7: 104,306,994 A113V probably benign Het
Ttn A G 2: 76,897,643 probably benign Het
Vmn1r213 A C 13: 23,011,423 probably benign Het
Vmn1r54 C A 6: 90,269,882 Y259* probably null Het
Vmn1r55 A G 7: 5,147,076 V116A probably benign Het
Vmn2r120 T C 17: 57,509,477 N626S probably damaging Het
Vmn2r58 A G 7: 41,872,627 F15S possibly damaging Het
Vmn2r73 A T 7: 85,871,560 V400E probably damaging Het
Zbtb39 A G 10: 127,742,827 I423M possibly damaging Het
Zfp352 A G 4: 90,225,164 N514D probably benign Het
Zfp451 A T 1: 33,777,413 H485Q probably damaging Het
Other mutations in Crybg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Crybg1 APN 10 43992509 missense probably damaging 1.00
IGL00502:Crybg1 APN 10 43958313 missense probably damaging 1.00
IGL00848:Crybg1 APN 10 43967818 splice site probably null
IGL01287:Crybg1 APN 10 43992494 missense possibly damaging 0.53
IGL01310:Crybg1 APN 10 43975058 missense possibly damaging 0.95
IGL01310:Crybg1 APN 10 44003600 missense probably damaging 0.99
IGL02683:Crybg1 APN 10 43989216 missense possibly damaging 0.64
IGL03095:Crybg1 APN 10 43989249 missense probably damaging 1.00
R0062:Crybg1 UTSW 10 43997906 missense probably damaging 0.98
R0142:Crybg1 UTSW 10 43999063 missense possibly damaging 0.83
R0294:Crybg1 UTSW 10 43986376 missense probably damaging 1.00
R0539:Crybg1 UTSW 10 43998898 missense probably benign 0.03
R0781:Crybg1 UTSW 10 43999093 missense possibly damaging 0.95
R1110:Crybg1 UTSW 10 43999093 missense possibly damaging 0.95
R1189:Crybg1 UTSW 10 43998794 missense probably damaging 1.00
R1428:Crybg1 UTSW 10 43975078 missense probably benign 0.33
R1521:Crybg1 UTSW 10 43998416 missense probably damaging 1.00
R1688:Crybg1 UTSW 10 43973798 missense probably damaging 1.00
R1728:Crybg1 UTSW 10 44004019 missense probably damaging 0.97
R1756:Crybg1 UTSW 10 43986279 missense probably damaging 1.00
R1773:Crybg1 UTSW 10 43992548 missense possibly damaging 0.91
R1784:Crybg1 UTSW 10 44004019 missense probably damaging 0.97
R1850:Crybg1 UTSW 10 43997674 missense probably damaging 1.00
R1911:Crybg1 UTSW 10 43997677 missense possibly damaging 0.47
R1920:Crybg1 UTSW 10 43997548 missense probably damaging 1.00
R1964:Crybg1 UTSW 10 43958330 missense probably damaging 1.00
R2298:Crybg1 UTSW 10 43999222 missense probably damaging 1.00
R3617:Crybg1 UTSW 10 43956786 missense possibly damaging 0.82
R3913:Crybg1 UTSW 10 43998763 missense possibly damaging 0.95
R4081:Crybg1 UTSW 10 43975039 missense probably damaging 1.00
R4116:Crybg1 UTSW 10 43999162 missense possibly damaging 0.91
R4583:Crybg1 UTSW 10 43997620 missense probably damaging 1.00
R4721:Crybg1 UTSW 10 43997887 missense probably damaging 1.00
R4818:Crybg1 UTSW 10 43998587 missense probably benign 0.00
R4859:Crybg1 UTSW 10 43992569 missense probably damaging 1.00
R4933:Crybg1 UTSW 10 43999213 missense probably damaging 1.00
R5028:Crybg1 UTSW 10 43998212 missense possibly damaging 0.74
R5057:Crybg1 UTSW 10 43989108 nonsense probably null
R5102:Crybg1 UTSW 10 43997836 missense probably damaging 1.00
R5103:Crybg1 UTSW 10 43997948 missense probably damaging 1.00
R5137:Crybg1 UTSW 10 43958336 missense probably damaging 1.00
R5212:Crybg1 UTSW 10 43967743 missense possibly damaging 0.95
R5307:Crybg1 UTSW 10 44003714 missense probably benign 0.00
R5353:Crybg1 UTSW 10 43973665 missense probably damaging 1.00
R5463:Crybg1 UTSW 10 44003693 nonsense probably null
R5503:Crybg1 UTSW 10 43998766 missense probably benign 0.00
R5583:Crybg1 UTSW 10 44003510 missense probably benign 0.01
R5835:Crybg1 UTSW 10 43975133 missense probably benign 0.28
R6021:Crybg1 UTSW 10 43997538 missense probably damaging 1.00
R6032:Crybg1 UTSW 10 43956760 missense probably damaging 1.00
R6032:Crybg1 UTSW 10 43956760 missense probably damaging 1.00
R6277:Crybg1 UTSW 10 43997259 missense probably benign 0.03
R6338:Crybg1 UTSW 10 43992509 missense probably damaging 1.00
R6348:Crybg1 UTSW 10 44003951 missense probably damaging 1.00
R6514:Crybg1 UTSW 10 43997215 missense probably damaging 1.00
R6785:Crybg1 UTSW 10 43999171 missense probably benign 0.00
R6804:Crybg1 UTSW 10 43966341 missense probably damaging 1.00
R6938:Crybg1 UTSW 10 43997383 missense probably benign 0.01
R6983:Crybg1 UTSW 10 43999342 missense probably damaging 1.00
R7002:Crybg1 UTSW 10 43998835 missense probably damaging 1.00
R7153:Crybg1 UTSW 10 43964666 missense possibly damaging 0.64
R7271:Crybg1 UTSW 10 43997623 nonsense probably null
R7293:Crybg1 UTSW 10 44003432 missense probably damaging 1.00
R7304:Crybg1 UTSW 10 43997258 missense probably benign 0.05
R7313:Crybg1 UTSW 10 43989111 missense probably damaging 0.98
R7373:Crybg1 UTSW 10 44004140 missense probably benign 0.00
R7449:Crybg1 UTSW 10 44004519 missense probably benign
R7530:Crybg1 UTSW 10 43999073 missense possibly damaging 0.62
R7660:Crybg1 UTSW 10 43998835 missense probably damaging 0.97
R7701:Crybg1 UTSW 10 43989143 missense probably benign 0.06
RF005:Crybg1 UTSW 10 44004745 missense probably benign 0.03
RF024:Crybg1 UTSW 10 44004745 missense probably benign 0.03
X0065:Crybg1 UTSW 10 43992526 synonymous silent
Z1088:Crybg1 UTSW 10 43997311 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAACTTGAACACAGCCATCTTG -3'
(R):5'- GAAGAGATTCGTCCAGCCAC -3'

Sequencing Primer
(F):5'- TTGAACACAGCCATCTTGGGGAG -3'
(R):5'- GAGATTCGTCCAGCCACCAGAG -3'
Posted On2015-07-07