Incidental Mutation 'R4409:Olfr1378'
ID327815
Institutional Source Beutler Lab
Gene Symbol Olfr1378
Ensembl Gene ENSMUSG00000050343
Gene Nameolfactory receptor 1378
SynonymsGA_x6K02T2QP88-4469162-4468215, MOR129-2
MMRRC Submission 041691-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R4409 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location50966530-50973113 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50969396 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 126 (I126N)
Ref Sequence ENSEMBL: ENSMUSP00000149432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052285] [ENSMUST00000213259]
Predicted Effect probably damaging
Transcript: ENSMUST00000052285
AA Change: I126N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058119
Gene: ENSMUSG00000050343
AA Change: I126N

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 5.1e-54 PFAM
Pfam:7tm_1 41 289 1.4e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213259
AA Change: I126N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A C 12: 118,872,922 L1085V probably damaging Het
Adgrf5 T C 17: 43,441,847 V560A probably damaging Het
Ambp C A 4: 63,152,647 S65I probably damaging Het
Ash1l A G 3: 89,007,199 D1712G probably damaging Het
Capn7 T C 14: 31,355,339 L338P probably damaging Het
Car2 T A 3: 14,895,102 S105T probably damaging Het
Casr A G 16: 36,500,341 C482R probably benign Het
Ccdc18 C T 5: 108,220,842 Q1277* probably null Het
Clca1 A G 3: 145,006,027 F736L probably damaging Het
Col6a1 T C 10: 76,721,500 H206R probably benign Het
Crybg1 C T 10: 43,998,758 A785T possibly damaging Het
Cyp2c68 T A 19: 39,739,452 E85D probably damaging Het
Dnah9 T C 11: 66,085,477 S1249G possibly damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fbxw24 A T 9: 109,608,188 D210E probably damaging Het
Fcgr1 T C 3: 96,284,577 Y305C probably benign Het
Gm10226 G T 17: 21,691,969 C37F possibly damaging Het
Gm13178 A T 4: 144,721,302 S35T possibly damaging Het
Gm8909 T A 17: 36,165,850 H244L possibly damaging Het
Greb1l A G 18: 10,503,182 Y411C possibly damaging Het
Grin1 T C 2: 25,310,439 N224D possibly damaging Het
Ighmbp2 C T 19: 3,271,536 V408I probably benign Het
Il1rap G A 16: 26,712,265 probably null Het
Iqcg A G 16: 33,045,518 probably null Het
Klhdc3 C T 17: 46,677,018 G249E probably damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Macrod2 T G 2: 140,418,857 H68Q possibly damaging Het
Morn4 T C 19: 42,078,547 T2A possibly damaging Het
Msc G C 1: 14,755,678 P24R probably damaging Het
Msh5 T C 17: 35,039,250 D300G probably damaging Het
Myo10 A G 15: 25,807,869 Y1859C probably damaging Het
Nacc1 A G 8: 84,673,044 *515Q probably null Het
Olfr722 T A 14: 49,895,773 T10S probably benign Het
Olfr998 T C 2: 85,590,930 L130S probably damaging Het
Oxgr1 C T 14: 120,022,160 V212M possibly damaging Het
P3h2 G C 16: 26,105,290 R132G possibly damaging Het
Pcdha9 T A 18: 36,999,145 H422Q probably benign Het
Pcdhga12 A G 18: 37,768,085 T657A probably damaging Het
Pcx A G 19: 4,610,003 K442R possibly damaging Het
Pkd2 T C 5: 104,466,884 silent Het
Plg T G 17: 12,390,263 C152G probably damaging Het
Plk4 A G 3: 40,806,549 E438G probably damaging Het
Ryr3 A G 2: 112,730,308 L3016P probably damaging Het
Sdccag8 T G 1: 176,868,366 probably null Het
Slc24a1 A T 9: 64,948,224 M467K probably benign Het
Sorl1 T G 9: 42,035,448 I856L probably damaging Het
Spag7 T C 11: 70,664,862 D83G probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmprss11b T C 5: 86,664,278 N170S probably benign Het
Tnfrsf1b G A 4: 145,224,285 Q253* probably null Het
Trim12a G A 7: 104,306,994 A113V probably benign Het
Ttn A G 2: 76,897,643 probably benign Het
Vmn1r213 A C 13: 23,011,423 probably benign Het
Vmn1r54 C A 6: 90,269,882 Y259* probably null Het
Vmn1r55 A G 7: 5,147,076 V116A probably benign Het
Vmn2r120 T C 17: 57,509,477 N626S probably damaging Het
Vmn2r58 A G 7: 41,872,627 F15S possibly damaging Het
Vmn2r73 A T 7: 85,871,560 V400E probably damaging Het
Zbtb39 A G 10: 127,742,827 I423M possibly damaging Het
Zfp352 A G 4: 90,225,164 N514D probably benign Het
Zfp451 A T 1: 33,777,413 H485Q probably damaging Het
Other mutations in Olfr1378
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Olfr1378 APN 11 50969119 missense probably benign 0.00
PIT4243001:Olfr1378 UTSW 11 50969552 missense probably damaging 1.00
R0540:Olfr1378 UTSW 11 50969843 missense possibly damaging 0.96
R0607:Olfr1378 UTSW 11 50969843 missense possibly damaging 0.96
R0699:Olfr1378 UTSW 11 50969818 missense probably damaging 1.00
R0719:Olfr1378 UTSW 11 50969934 nonsense probably null
R2117:Olfr1378 UTSW 11 50969320 missense probably damaging 0.98
R2263:Olfr1378 UTSW 11 50969869 missense possibly damaging 0.75
R3402:Olfr1378 UTSW 11 50969068 missense probably benign
R3767:Olfr1378 UTSW 11 50969558 missense probably damaging 1.00
R3768:Olfr1378 UTSW 11 50969558 missense probably damaging 1.00
R3769:Olfr1378 UTSW 11 50969558 missense probably damaging 1.00
R4293:Olfr1378 UTSW 11 50969426 missense probably damaging 1.00
R4446:Olfr1378 UTSW 11 50969863 missense probably damaging 1.00
R4731:Olfr1378 UTSW 11 50969266 missense possibly damaging 0.78
R4732:Olfr1378 UTSW 11 50969266 missense possibly damaging 0.78
R4733:Olfr1378 UTSW 11 50969266 missense possibly damaging 0.78
R5437:Olfr1378 UTSW 11 50969108 missense probably benign 0.02
R6085:Olfr1378 UTSW 11 50969123 missense probably damaging 1.00
R6648:Olfr1378 UTSW 11 50969173 missense probably damaging 1.00
R7419:Olfr1378 UTSW 11 50969325 nonsense probably null
R7686:Olfr1378 UTSW 11 50969755 missense possibly damaging 0.92
X0011:Olfr1378 UTSW 11 50969654 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CATCAGCTGTGACCCTCATC -3'
(R):5'- TTCAGGATAGGGTAGGGGTCAC -3'

Sequencing Primer
(F):5'- GGCCAACCTCTCCAGTGTTG -3'
(R):5'- TCACAGAAGAAGTGGTGCATTGC -3'
Posted On2015-07-07