Incidental Mutation 'R4409:Casr'
ID327829
Institutional Source Beutler Lab
Gene Symbol Casr
Ensembl Gene ENSMUSG00000051980
Gene Namecalcium-sensing receptor
SynonymsCaR, cation sensing receptor, Gprc2a
MMRRC Submission 041691-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4409 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location36493696-36562141 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36500341 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 482 (C482R)
Ref Sequence ENSEMBL: ENSMUSP00000133500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063597] [ENSMUST00000114847] [ENSMUST00000172826]
Predicted Effect probably benign
Transcript: ENSMUST00000063597
AA Change: C482R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000069080
Gene: ENSMUSG00000051980
AA Change: C482R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Peripla_BP_6 63 321 1e-13 PFAM
Pfam:ANF_receptor 69 495 1.1e-114 PFAM
Pfam:NCD3G 538 591 1.4e-20 PFAM
Pfam:7tm_3 624 859 7.4e-61 PFAM
low complexity region 894 920 N/A INTRINSIC
low complexity region 930 961 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114847
SMART Domains Protein: ENSMUSP00000110496
Gene: ENSMUSG00000051980

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Peripla_BP_6 63 321 2.1e-14 PFAM
Pfam:ANF_receptor 69 461 2.8e-99 PFAM
Pfam:NCD3G 461 514 1.2e-20 PFAM
Pfam:7tm_3 545 783 9.9e-87 PFAM
low complexity region 817 843 N/A INTRINSIC
low complexity region 853 884 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172826
AA Change: C482R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000133500
Gene: ENSMUSG00000051980
AA Change: C482R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Peripla_BP_6 63 321 2.4e-14 PFAM
Pfam:ANF_receptor 69 495 3.9e-111 PFAM
Pfam:NCD3G 538 591 1.4e-20 PFAM
Pfam:7tm_3 622 860 1.1e-86 PFAM
low complexity region 894 920 N/A INTRINSIC
low complexity region 930 961 N/A INTRINSIC
Meta Mutation Damage Score 0.0968 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G protein-coupled receptor that is expressed in the parathyroid hormone (PTH)-producing chief cells of the parathyroid gland, and the cells lining the kidney tubule. It senses small changes in circulating calcium concentration and couples this information to intracellular signaling pathways that modify PTH secretion or renal cation handling, thus this protein plays an essential role in maintaining mineral ion homeostasis. Mutations in this gene cause familial hypocalciuric hypercalcemia, familial, isolated hypoparathyroidism, and neonatal severe primary hyperparathyroidism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high levels of serum calcium and parathyroid hormone, parathyroid hyperplasia, bone defects, reduced growth, and early death. Carriers have elevated serum calcium, magnesium, and parathyroid hormone levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A C 12: 118,872,922 L1085V probably damaging Het
Adgrf5 T C 17: 43,441,847 V560A probably damaging Het
Ambp C A 4: 63,152,647 S65I probably damaging Het
Ash1l A G 3: 89,007,199 D1712G probably damaging Het
Capn7 T C 14: 31,355,339 L338P probably damaging Het
Car2 T A 3: 14,895,102 S105T probably damaging Het
Ccdc18 C T 5: 108,220,842 Q1277* probably null Het
Clca1 A G 3: 145,006,027 F736L probably damaging Het
Col6a1 T C 10: 76,721,500 H206R probably benign Het
Crybg1 C T 10: 43,998,758 A785T possibly damaging Het
Cyp2c68 T A 19: 39,739,452 E85D probably damaging Het
Dnah9 T C 11: 66,085,477 S1249G possibly damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fbxw24 A T 9: 109,608,188 D210E probably damaging Het
Fcgr1 T C 3: 96,284,577 Y305C probably benign Het
Gm10226 G T 17: 21,691,969 C37F possibly damaging Het
Gm13178 A T 4: 144,721,302 S35T possibly damaging Het
Gm8909 T A 17: 36,165,850 H244L possibly damaging Het
Greb1l A G 18: 10,503,182 Y411C possibly damaging Het
Grin1 T C 2: 25,310,439 N224D possibly damaging Het
Ighmbp2 C T 19: 3,271,536 V408I probably benign Het
Il1rap G A 16: 26,712,265 probably null Het
Iqcg A G 16: 33,045,518 probably null Het
Klhdc3 C T 17: 46,677,018 G249E probably damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Macrod2 T G 2: 140,418,857 H68Q possibly damaging Het
Morn4 T C 19: 42,078,547 T2A possibly damaging Het
Msc G C 1: 14,755,678 P24R probably damaging Het
Msh5 T C 17: 35,039,250 D300G probably damaging Het
Myo10 A G 15: 25,807,869 Y1859C probably damaging Het
Nacc1 A G 8: 84,673,044 *515Q probably null Het
Olfr1378 T A 11: 50,969,396 I126N probably damaging Het
Olfr722 T A 14: 49,895,773 T10S probably benign Het
Olfr998 T C 2: 85,590,930 L130S probably damaging Het
Oxgr1 C T 14: 120,022,160 V212M possibly damaging Het
P3h2 G C 16: 26,105,290 R132G possibly damaging Het
Pcdha9 T A 18: 36,999,145 H422Q probably benign Het
Pcdhga12 A G 18: 37,768,085 T657A probably damaging Het
Pcx A G 19: 4,610,003 K442R possibly damaging Het
Pkd2 T C 5: 104,466,884 silent Het
Plg T G 17: 12,390,263 C152G probably damaging Het
Plk4 A G 3: 40,806,549 E438G probably damaging Het
Ryr3 A G 2: 112,730,308 L3016P probably damaging Het
Sdccag8 T G 1: 176,868,366 probably null Het
Slc24a1 A T 9: 64,948,224 M467K probably benign Het
Sorl1 T G 9: 42,035,448 I856L probably damaging Het
Spag7 T C 11: 70,664,862 D83G probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmprss11b T C 5: 86,664,278 N170S probably benign Het
Tnfrsf1b G A 4: 145,224,285 Q253* probably null Het
Trim12a G A 7: 104,306,994 A113V probably benign Het
Ttn A G 2: 76,897,643 probably benign Het
Vmn1r213 A C 13: 23,011,423 probably benign Het
Vmn1r54 C A 6: 90,269,882 Y259* probably null Het
Vmn1r55 A G 7: 5,147,076 V116A probably benign Het
Vmn2r120 T C 17: 57,509,477 N626S probably damaging Het
Vmn2r58 A G 7: 41,872,627 F15S possibly damaging Het
Vmn2r73 A T 7: 85,871,560 V400E probably damaging Het
Zbtb39 A G 10: 127,742,827 I423M possibly damaging Het
Zfp352 A G 4: 90,225,164 N514D probably benign Het
Zfp451 A T 1: 33,777,413 H485Q probably damaging Het
Other mutations in Casr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Casr APN 16 36495810 missense probably damaging 1.00
IGL01587:Casr APN 16 36509765 missense probably benign
IGL02323:Casr APN 16 36509710 missense probably damaging 1.00
IGL02369:Casr APN 16 36494689 missense probably benign 0.03
IGL02514:Casr APN 16 36500325 missense probably damaging 1.00
IGL02547:Casr APN 16 36515674 missense probably benign 0.06
IGL02633:Casr APN 16 36515655 missense probably damaging 1.00
IGL03061:Casr APN 16 36495888 missense probably benign 0.07
R1163:Casr UTSW 16 36494807 missense probably damaging 1.00
R1539:Casr UTSW 16 36495137 missense probably benign 0.10
R1643:Casr UTSW 16 36500205 missense probably damaging 1.00
R1664:Casr UTSW 16 36509965 nonsense probably null
R1694:Casr UTSW 16 36495591 missense probably damaging 1.00
R2040:Casr UTSW 16 36510366 missense possibly damaging 0.79
R2092:Casr UTSW 16 36510043 missense possibly damaging 0.96
R2125:Casr UTSW 16 36495252 missense possibly damaging 0.90
R2190:Casr UTSW 16 36495416 missense probably damaging 1.00
R2214:Casr UTSW 16 36515758 missense probably damaging 1.00
R4410:Casr UTSW 16 36500341 missense probably benign 0.01
R4591:Casr UTSW 16 36500370 missense probably benign 0.05
R5451:Casr UTSW 16 36509908 missense probably damaging 0.99
R5469:Casr UTSW 16 36510030 missense probably benign 0.29
R5581:Casr UTSW 16 36494744 missense probably benign 0.01
R5700:Casr UTSW 16 36509617 missense probably damaging 0.99
R6258:Casr UTSW 16 36517609 missense probably damaging 1.00
R6447:Casr UTSW 16 36495545 missense probably damaging 1.00
R6751:Casr UTSW 16 36515588 missense probably benign 0.00
R6938:Casr UTSW 16 36495921 missense probably damaging 1.00
R7063:Casr UTSW 16 36494574 missense probably benign 0.00
R7313:Casr UTSW 16 36509671 missense probably damaging 1.00
R7789:Casr UTSW 16 36495291 missense probably damaging 1.00
R8013:Casr UTSW 16 36509644 missense probably benign 0.22
R8026:Casr UTSW 16 36495617 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCATACCTCTCTGGAGAAC -3'
(R):5'- CTTACCAGAGCTACCACAGG -3'

Sequencing Primer
(F):5'- TACCTCTCTGGAGAACCCACTC -3'
(R):5'- GAGCTACCACAGGCACAG -3'
Posted On2015-07-07