Incidental Mutation 'R4409:Plg'
ID327830
Institutional Source Beutler Lab
Gene Symbol Plg
Ensembl Gene ENSMUSG00000059481
Gene Nameplasminogen
SynonymsPg
MMRRC Submission 041691-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.312) question?
Stock #R4409 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location12378609-12419384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 12390263 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 152 (C152G)
Ref Sequence ENSEMBL: ENSMUSP00000014578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014578]
Predicted Effect probably damaging
Transcript: ENSMUST00000014578
AA Change: C152G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000014578
Gene: ENSMUSG00000059481
AA Change: C152G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PAN_AP 20 97 8.67e-14 SMART
KR 101 183 1.31e-41 SMART
KR 184 264 5.4e-43 SMART
KR 273 354 3.45e-50 SMART
KR 375 456 3.9e-49 SMART
KR 479 562 5.53e-40 SMART
Tryp_SPc 581 805 4.11e-94 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secreted blood zymogen that is activated by proteolysis and converted to plasmin and angiostatin. Plasmin dissolves fibrin in blood clots and is an important protease in many other cellular processes while angiostatin inhibits angiogenesis. Defects in this gene are likely a cause of thrombophilia and ligneous conjunctivitis. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous null mutants exhibit retarded growth, variable rectal prolapse, impaired fertility and lactation in females, early mortality, and widespread fibrin deposition and thrombotic lesions in liver, lung, stomach and other tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A C 12: 118,872,922 L1085V probably damaging Het
Adgrf5 T C 17: 43,441,847 V560A probably damaging Het
Ambp C A 4: 63,152,647 S65I probably damaging Het
Ash1l A G 3: 89,007,199 D1712G probably damaging Het
Capn7 T C 14: 31,355,339 L338P probably damaging Het
Car2 T A 3: 14,895,102 S105T probably damaging Het
Casr A G 16: 36,500,341 C482R probably benign Het
Ccdc18 C T 5: 108,220,842 Q1277* probably null Het
Clca1 A G 3: 145,006,027 F736L probably damaging Het
Col6a1 T C 10: 76,721,500 H206R probably benign Het
Crybg1 C T 10: 43,998,758 A785T possibly damaging Het
Cyp2c68 T A 19: 39,739,452 E85D probably damaging Het
Dnah9 T C 11: 66,085,477 S1249G possibly damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fbxw24 A T 9: 109,608,188 D210E probably damaging Het
Fcgr1 T C 3: 96,284,577 Y305C probably benign Het
Gm10226 G T 17: 21,691,969 C37F possibly damaging Het
Gm13178 A T 4: 144,721,302 S35T possibly damaging Het
Gm8909 T A 17: 36,165,850 H244L possibly damaging Het
Greb1l A G 18: 10,503,182 Y411C possibly damaging Het
Grin1 T C 2: 25,310,439 N224D possibly damaging Het
Ighmbp2 C T 19: 3,271,536 V408I probably benign Het
Il1rap G A 16: 26,712,265 probably null Het
Iqcg A G 16: 33,045,518 probably null Het
Klhdc3 C T 17: 46,677,018 G249E probably damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Macrod2 T G 2: 140,418,857 H68Q possibly damaging Het
Morn4 T C 19: 42,078,547 T2A possibly damaging Het
Msc G C 1: 14,755,678 P24R probably damaging Het
Msh5 T C 17: 35,039,250 D300G probably damaging Het
Myo10 A G 15: 25,807,869 Y1859C probably damaging Het
Nacc1 A G 8: 84,673,044 *515Q probably null Het
Olfr1378 T A 11: 50,969,396 I126N probably damaging Het
Olfr722 T A 14: 49,895,773 T10S probably benign Het
Olfr998 T C 2: 85,590,930 L130S probably damaging Het
Oxgr1 C T 14: 120,022,160 V212M possibly damaging Het
P3h2 G C 16: 26,105,290 R132G possibly damaging Het
Pcdha9 T A 18: 36,999,145 H422Q probably benign Het
Pcdhga12 A G 18: 37,768,085 T657A probably damaging Het
Pcx A G 19: 4,610,003 K442R possibly damaging Het
Pkd2 T C 5: 104,466,884 silent Het
Plk4 A G 3: 40,806,549 E438G probably damaging Het
Ryr3 A G 2: 112,730,308 L3016P probably damaging Het
Sdccag8 T G 1: 176,868,366 probably null Het
Slc24a1 A T 9: 64,948,224 M467K probably benign Het
Sorl1 T G 9: 42,035,448 I856L probably damaging Het
Spag7 T C 11: 70,664,862 D83G probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmprss11b T C 5: 86,664,278 N170S probably benign Het
Tnfrsf1b G A 4: 145,224,285 Q253* probably null Het
Trim12a G A 7: 104,306,994 A113V probably benign Het
Ttn A G 2: 76,897,643 probably benign Het
Vmn1r213 A C 13: 23,011,423 probably benign Het
Vmn1r54 C A 6: 90,269,882 Y259* probably null Het
Vmn1r55 A G 7: 5,147,076 V116A probably benign Het
Vmn2r120 T C 17: 57,509,477 N626S probably damaging Het
Vmn2r58 A G 7: 41,872,627 F15S possibly damaging Het
Vmn2r73 A T 7: 85,871,560 V400E probably damaging Het
Zbtb39 A G 10: 127,742,827 I423M possibly damaging Het
Zfp352 A G 4: 90,225,164 N514D probably benign Het
Zfp451 A T 1: 33,777,413 H485Q probably damaging Het
Other mutations in Plg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Plg APN 17 12411493 missense probably damaging 1.00
IGL01128:Plg APN 17 12396699 splice site probably benign
IGL01522:Plg APN 17 12404069 missense probably damaging 1.00
IGL01981:Plg APN 17 12403047 splice site probably benign
IGL03338:Plg APN 17 12419072 missense probably damaging 1.00
R0391:Plg UTSW 17 12419081 missense probably damaging 1.00
R0531:Plg UTSW 17 12411447 splice site probably benign
R0646:Plg UTSW 17 12418736 missense probably damaging 1.00
R0759:Plg UTSW 17 12410951 missense probably damaging 1.00
R1013:Plg UTSW 17 12378721 splice site probably benign
R2116:Plg UTSW 17 12384477 missense probably damaging 0.99
R2442:Plg UTSW 17 12410960 missense probably benign 0.15
R2512:Plg UTSW 17 12403229 missense probably benign
R2879:Plg UTSW 17 12404100 missense possibly damaging 0.92
R3107:Plg UTSW 17 12384429 missense probably benign 0.00
R3405:Plg UTSW 17 12403209 missense possibly damaging 0.65
R4861:Plg UTSW 17 12395735 missense probably benign 0.00
R4861:Plg UTSW 17 12395735 missense probably benign 0.00
R4977:Plg UTSW 17 12403089 missense probably damaging 1.00
R4990:Plg UTSW 17 12411510 missense probably benign
R5319:Plg UTSW 17 12403227 missense possibly damaging 0.49
R5443:Plg UTSW 17 12382183 missense probably benign 0.03
R5635:Plg UTSW 17 12395754 missense probably damaging 1.00
R5981:Plg UTSW 17 12378718 critical splice donor site probably null
R6166:Plg UTSW 17 12398114 missense probably damaging 0.99
R6688:Plg UTSW 17 12391845 missense probably damaging 1.00
R6726:Plg UTSW 17 12378708 missense probably damaging 1.00
R6995:Plg UTSW 17 12419051 missense probably benign 0.00
R7028:Plg UTSW 17 12391836 missense probably damaging 1.00
R7168:Plg UTSW 17 12388559 missense probably damaging 1.00
R7356:Plg UTSW 17 12410911 missense probably damaging 1.00
Z1176:Plg UTSW 17 12414185 missense probably benign 0.02
Z1177:Plg UTSW 17 12403233 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCTGTTTGACCCAAGCTTTC -3'
(R):5'- GGACTCCTTCATAAGAGCAAGC -3'

Sequencing Primer
(F):5'- CCCAAGCTTTCCATCTGTAGATAAAG -3'
(R):5'- CTTGTCCGGATCTGTAGT -3'
Posted On2015-07-07