Incidental Mutation 'R4409:Klhdc3'
ID327835
Institutional Source Beutler Lab
Gene Symbol Klhdc3
Ensembl Gene ENSMUSG00000063576
Gene Namekelch domain containing 3
Synonyms1300011D16Rik, Peas
MMRRC Submission 041691-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.831) question?
Stock #R4409 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location46674550-46680930 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 46677018 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 249 (G249E)
Ref Sequence ENSEMBL: ENSMUSP00000128271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002845] [ENSMUST00000024766] [ENSMUST00000071841] [ENSMUST00000165007]
Predicted Effect probably benign
Transcript: ENSMUST00000002845
SMART Domains Protein: ENSMUSP00000002845
Gene: ENSMUSG00000002768

DomainStartEndE-ValueType
Pfam:MEA1 1 174 1.6e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000024766
SMART Domains Protein: ENSMUSP00000024766
Gene: ENSMUSG00000023971

DomainStartEndE-ValueType
Pfam:DUF947 55 219 7.6e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000071841
AA Change: G249E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071743
Gene: ENSMUSG00000063576
AA Change: G249E

DomainStartEndE-ValueType
Pfam:Kelch_1 13 63 1.6e-8 PFAM
Pfam:Kelch_2 13 63 2.2e-9 PFAM
Pfam:Kelch_4 13 65 3.8e-8 PFAM
Pfam:Kelch_6 13 67 9.6e-11 PFAM
Pfam:Kelch_5 73 113 3.1e-8 PFAM
Pfam:Kelch_1 76 117 1.9e-7 PFAM
Pfam:Kelch_6 76 121 1.7e-9 PFAM
Pfam:Kelch_2 77 121 2.1e-8 PFAM
Pfam:Kelch_4 77 125 4.6e-11 PFAM
Pfam:Kelch_3 86 136 1.3e-12 PFAM
Pfam:Kelch_1 127 172 1.5e-10 PFAM
Pfam:Kelch_6 127 173 2e-10 PFAM
Pfam:Kelch_2 127 174 4.7e-14 PFAM
Pfam:Kelch_4 127 177 1.3e-10 PFAM
Pfam:Kelch_2 179 231 2.4e-8 PFAM
Pfam:Kelch_1 180 233 5.8e-9 PFAM
Pfam:Kelch_3 189 247 7.3e-8 PFAM
Pfam:Kelch_5 235 276 1.2e-11 PFAM
Pfam:Kelch_1 238 284 2.7e-8 PFAM
Pfam:Kelch_6 238 293 2.4e-12 PFAM
Pfam:Kelch_3 248 299 4.2e-10 PFAM
low complexity region 322 333 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165007
AA Change: G249E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128271
Gene: ENSMUSG00000063576
AA Change: G249E

DomainStartEndE-ValueType
Pfam:Kelch_1 13 63 9.9e-10 PFAM
Pfam:Kelch_2 13 63 2.2e-9 PFAM
Pfam:Kelch_6 13 66 7.5e-11 PFAM
Pfam:Kelch_4 13 71 1.4e-8 PFAM
Pfam:Kelch_5 73 113 3e-8 PFAM
Pfam:Kelch_1 76 118 2.6e-8 PFAM
Pfam:Kelch_6 76 121 1.1e-10 PFAM
Pfam:Kelch_4 76 126 2e-11 PFAM
Pfam:Kelch_2 77 121 2.1e-8 PFAM
Pfam:Kelch_3 86 136 7.7e-12 PFAM
Pfam:Kelch_1 127 170 1.2e-8 PFAM
Pfam:Kelch_2 127 174 4.7e-14 PFAM
Pfam:Kelch_4 127 177 1.7e-7 PFAM
Pfam:Kelch_2 179 231 2.4e-8 PFAM
Pfam:Kelch_6 179 239 2.5e-9 PFAM
Pfam:Kelch_1 180 232 3.4e-8 PFAM
Pfam:Kelch_3 189 247 5.7e-8 PFAM
Pfam:Kelch_5 235 276 4.3e-10 PFAM
Pfam:Kelch_1 238 285 9.3e-10 PFAM
Pfam:Kelch_4 238 291 9.9e-8 PFAM
Pfam:Kelch_6 238 293 2.5e-12 PFAM
Pfam:Kelch_3 248 299 1.1e-9 PFAM
low complexity region 322 333 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains six repeated kelch motifs that are structurally similar to recombination activating gene 2, a protein involved in the activation of the V(D)J recombination. In mouse, this gene is found to be expressed specifically in testis. Its expression in pachytene spermatocytes is localized to cytoplasma and meiotic chromatin, suggesting that this gene may be involved in meiotic recombination. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A C 12: 118,872,922 L1085V probably damaging Het
Adgrf5 T C 17: 43,441,847 V560A probably damaging Het
Ambp C A 4: 63,152,647 S65I probably damaging Het
Ash1l A G 3: 89,007,199 D1712G probably damaging Het
Capn7 T C 14: 31,355,339 L338P probably damaging Het
Car2 T A 3: 14,895,102 S105T probably damaging Het
Casr A G 16: 36,500,341 C482R probably benign Het
Ccdc18 C T 5: 108,220,842 Q1277* probably null Het
Clca1 A G 3: 145,006,027 F736L probably damaging Het
Col6a1 T C 10: 76,721,500 H206R probably benign Het
Crybg1 C T 10: 43,998,758 A785T possibly damaging Het
Cyp2c68 T A 19: 39,739,452 E85D probably damaging Het
Dnah9 T C 11: 66,085,477 S1249G possibly damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fbxw24 A T 9: 109,608,188 D210E probably damaging Het
Fcgr1 T C 3: 96,284,577 Y305C probably benign Het
Gm10226 G T 17: 21,691,969 C37F possibly damaging Het
Gm13178 A T 4: 144,721,302 S35T possibly damaging Het
Gm8909 T A 17: 36,165,850 H244L possibly damaging Het
Greb1l A G 18: 10,503,182 Y411C possibly damaging Het
Grin1 T C 2: 25,310,439 N224D possibly damaging Het
Ighmbp2 C T 19: 3,271,536 V408I probably benign Het
Il1rap G A 16: 26,712,265 probably null Het
Iqcg A G 16: 33,045,518 probably null Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Macrod2 T G 2: 140,418,857 H68Q possibly damaging Het
Morn4 T C 19: 42,078,547 T2A possibly damaging Het
Msc G C 1: 14,755,678 P24R probably damaging Het
Msh5 T C 17: 35,039,250 D300G probably damaging Het
Myo10 A G 15: 25,807,869 Y1859C probably damaging Het
Nacc1 A G 8: 84,673,044 *515Q probably null Het
Olfr1378 T A 11: 50,969,396 I126N probably damaging Het
Olfr722 T A 14: 49,895,773 T10S probably benign Het
Olfr998 T C 2: 85,590,930 L130S probably damaging Het
Oxgr1 C T 14: 120,022,160 V212M possibly damaging Het
P3h2 G C 16: 26,105,290 R132G possibly damaging Het
Pcdha9 T A 18: 36,999,145 H422Q probably benign Het
Pcdhga12 A G 18: 37,768,085 T657A probably damaging Het
Pcx A G 19: 4,610,003 K442R possibly damaging Het
Pkd2 T C 5: 104,466,884 silent Het
Plg T G 17: 12,390,263 C152G probably damaging Het
Plk4 A G 3: 40,806,549 E438G probably damaging Het
Ryr3 A G 2: 112,730,308 L3016P probably damaging Het
Sdccag8 T G 1: 176,868,366 probably null Het
Slc24a1 A T 9: 64,948,224 M467K probably benign Het
Sorl1 T G 9: 42,035,448 I856L probably damaging Het
Spag7 T C 11: 70,664,862 D83G probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmprss11b T C 5: 86,664,278 N170S probably benign Het
Tnfrsf1b G A 4: 145,224,285 Q253* probably null Het
Trim12a G A 7: 104,306,994 A113V probably benign Het
Ttn A G 2: 76,897,643 probably benign Het
Vmn1r213 A C 13: 23,011,423 probably benign Het
Vmn1r54 C A 6: 90,269,882 Y259* probably null Het
Vmn1r55 A G 7: 5,147,076 V116A probably benign Het
Vmn2r120 T C 17: 57,509,477 N626S probably damaging Het
Vmn2r58 A G 7: 41,872,627 F15S possibly damaging Het
Vmn2r73 A T 7: 85,871,560 V400E probably damaging Het
Zbtb39 A G 10: 127,742,827 I423M possibly damaging Het
Zfp352 A G 4: 90,225,164 N514D probably benign Het
Zfp451 A T 1: 33,777,413 H485Q probably damaging Het
Other mutations in Klhdc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02491:Klhdc3 APN 17 46677300 missense possibly damaging 0.82
pinto UTSW 17 46678046 missense probably benign 0.36
shetland UTSW 17 46678292 missense possibly damaging 0.63
R0667:Klhdc3 UTSW 17 46677225 missense probably benign 0.07
R0960:Klhdc3 UTSW 17 46676518 missense possibly damaging 0.89
R1254:Klhdc3 UTSW 17 46678067 missense probably benign
R1263:Klhdc3 UTSW 17 46676966 missense probably benign 0.00
R1954:Klhdc3 UTSW 17 46677975 missense probably damaging 1.00
R2093:Klhdc3 UTSW 17 46677953 missense probably benign 0.00
R3808:Klhdc3 UTSW 17 46677932 missense possibly damaging 0.89
R3809:Klhdc3 UTSW 17 46677932 missense possibly damaging 0.89
R4799:Klhdc3 UTSW 17 46677300 missense possibly damaging 0.82
R5807:Klhdc3 UTSW 17 46677465 missense probably damaging 0.98
R5958:Klhdc3 UTSW 17 46675102 missense probably benign 0.12
R6152:Klhdc3 UTSW 17 46677707 missense probably damaging 1.00
R6295:Klhdc3 UTSW 17 46678046 missense probably benign 0.36
R6521:Klhdc3 UTSW 17 46677761 missense probably benign 0.20
R6851:Klhdc3 UTSW 17 46678292 missense possibly damaging 0.63
R7524:Klhdc3 UTSW 17 46678414 missense probably damaging 0.99
Z1177:Klhdc3 UTSW 17 46676751 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTCACTACCTGGCCAACCTAG -3'
(R):5'- GGGCCATTTCATTCCAACAATG -3'

Sequencing Primer
(F):5'- TGGCCAACCTAGACACCTAC -3'
(R):5'- CCAACAATGAGATCTACTGTAATCG -3'
Posted On2015-07-07