Mutagenetix > Incidental Mutation

Incidental Mutation 'R4409:Greb1l'

327837

Institutional Source

Beutler Lab

Gene Symbol

Greb1l

Ensembl Gene

ENSMUSG00000042942

Gene Name

growth regulation by estrogen in breast cancer-like

Synonyms

AK220484, mKIAA4095

MMRRC Submission

041691-MU

Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4409 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

10325177-10562934 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 10503182 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 411 (Y411C)

Ref Sequence

ENSEMBL: ENSMUSP00000134090 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532]

AlphaFold

B9EJV3

Predicted Effect

probably benign
Transcript: ENSMUST00000048977
AA Change: Y411C

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: Y411C

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1172	N/A	PFAM
Pfam:GREB1	1154	1913	N/A	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172532
AA Change: Y411C

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942
AA Change: Y411C

Domain	Start	End	E-Value	Type
low complexity region	83	100	N/A	INTRINSIC
low complexity region	282	301	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173356

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224958

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb5	A	C	12: 118,872,922	L1085V	probably damaging	Het
Adgrf5	T	C	17: 43,441,847	V560A	probably damaging	Het
Ambp	C	A	4: 63,152,647	S65I	probably damaging	Het
Ash1l	A	G	3: 89,007,199	D1712G	probably damaging	Het
Capn7	T	C	14: 31,355,339	L338P	probably damaging	Het
Car2	T	A	3: 14,895,102	S105T	probably damaging	Het
Casr	A	G	16: 36,500,341	C482R	probably benign	Het
Ccdc18	C	T	5: 108,220,842	Q1277*	probably null	Het
Clca1	A	G	3: 145,006,027	F736L	probably damaging	Het
Col6a1	T	C	10: 76,721,500	H206R	probably benign	Het
Crybg1	C	T	10: 43,998,758	A785T	possibly damaging	Het
Cyp2c68	T	A	19: 39,739,452	E85D	probably damaging	Het
Dnah9	T	C	11: 66,085,477	S1249G	possibly damaging	Het
E2f1	C	G	2: 154,564,022	G144R	probably damaging	Het
Fbxw24	A	T	9: 109,608,188	D210E	probably damaging	Het
Fcgr1	T	C	3: 96,284,577	Y305C	probably benign	Het
Gm10226	G	T	17: 21,691,969	C37F	possibly damaging	Het
Gm13178	A	T	4: 144,721,302	S35T	possibly damaging	Het
Gm8909	T	A	17: 36,165,850	H244L	possibly damaging	Het
Grin1	T	C	2: 25,310,439	N224D	possibly damaging	Het
Ighmbp2	C	T	19: 3,271,536	V408I	probably benign	Het
Il1rap	G	A	16: 26,712,265		probably null	Het
Iqcg	A	G	16: 33,045,518		probably null	Het
Klhdc3	C	T	17: 46,677,018	G249E	probably damaging	Het
Lct	T	C	1: 128,304,226	M629V	probably damaging	Het
Macrod2	T	G	2: 140,418,857	H68Q	possibly damaging	Het
Morn4	T	C	19: 42,078,547	T2A	possibly damaging	Het
Msc	G	C	1: 14,755,678	P24R	probably damaging	Het
Msh5	T	C	17: 35,039,250	D300G	probably damaging	Het
Myo10	A	G	15: 25,807,869	Y1859C	probably damaging	Het
Nacc1	A	G	8: 84,673,044	*515Q	probably null	Het
Olfr1378	T	A	11: 50,969,396	I126N	probably damaging	Het
Olfr722	T	A	14: 49,895,773	T10S	probably benign	Het
Olfr998	T	C	2: 85,590,930	L130S	probably damaging	Het
Oxgr1	C	T	14: 120,022,160	V212M	possibly damaging	Het
P3h2	G	C	16: 26,105,290	R132G	possibly damaging	Het
Pcdha9	T	A	18: 36,999,145	H422Q	probably benign	Het
Pcdhga12	A	G	18: 37,768,085	T657A	probably damaging	Het
Pcx	A	G	19: 4,610,003	K442R	possibly damaging	Het
Pkd2	T	C	5: 104,466,884		silent	Het
Plg	T	G	17: 12,390,263	C152G	probably damaging	Het
Plk4	A	G	3: 40,806,549	E438G	probably damaging	Het
Ryr3	A	G	2: 112,730,308	L3016P	probably damaging	Het
Sdccag8	T	G	1: 176,868,366		probably null	Het
Slc24a1	A	T	9: 64,948,224	M467K	probably benign	Het
Sorl1	T	G	9: 42,035,448	I856L	probably damaging	Het
Spag7	T	C	11: 70,664,862	D83G	probably damaging	Het
Tmem59l	A	G	8: 70,487,301	L6S	unknown	Het
Tmprss11b	T	C	5: 86,664,278	N170S	probably benign	Het
Tnfrsf1b	G	A	4: 145,224,285	Q253*	probably null	Het
Trim12a	G	A	7: 104,306,994	A113V	probably benign	Het
Ttn	A	G	2: 76,897,643		probably benign	Het
Vmn1r213	A	C	13: 23,011,423		probably benign	Het
Vmn1r54	C	A	6: 90,269,882	Y259*	probably null	Het
Vmn1r55	A	G	7: 5,147,076	V116A	probably benign	Het
Vmn2r120	T	C	17: 57,509,477	N626S	probably damaging	Het
Vmn2r58	A	G	7: 41,872,627	F15S	possibly damaging	Het
Vmn2r73	A	T	7: 85,871,560	V400E	probably damaging	Het
Zbtb39	A	G	10: 127,742,827	I423M	possibly damaging	Het
Zfp352	A	G	4: 90,225,164	N514D	probably benign	Het
Zfp451	A	T	1: 33,777,413	H485Q	probably damaging	Het

Other mutations in Greb1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Greb1l	APN	18	10555962	missense	possibly damaging	0.90
IGL01554:Greb1l	APN	18	10522144	missense	probably benign	0.01
IGL01563:Greb1l	APN	18	10469399	missense	probably damaging	0.99
IGL01944:Greb1l	APN	18	10557280	missense	possibly damaging	0.91
IGL02110:Greb1l	APN	18	10515271	missense	probably damaging	1.00
IGL02249:Greb1l	APN	18	10532961	missense	probably damaging	1.00
IGL02318:Greb1l	APN	18	10469388	missense	possibly damaging	0.91
IGL02340:Greb1l	APN	18	10515200	missense	probably damaging	0.99
IGL02516:Greb1l	APN	18	10537064	missense	probably benign	0.31
IGL02566:Greb1l	APN	18	10503299	missense	probably damaging	0.99
IGL02583:Greb1l	APN	18	10542362	missense	probably damaging	1.00
IGL02838:Greb1l	APN	18	10560430	missense	probably damaging	1.00
A4554:Greb1l	UTSW	18	10532862	missense	possibly damaging	0.58
PIT4453001:Greb1l	UTSW	18	10533031	missense	probably damaging	0.98
PIT4453001:Greb1l	UTSW	18	10533032	missense	probably benign	0.08
R0099:Greb1l	UTSW	18	10509158	missense	probably damaging	1.00
R0226:Greb1l	UTSW	18	10522076	intron	probably benign
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0239:Greb1l	UTSW	18	10458567	splice site	probably benign
R0316:Greb1l	UTSW	18	10547420	missense	probably damaging	1.00
R0369:Greb1l	UTSW	18	10469375	missense	possibly damaging	0.80
R0394:Greb1l	UTSW	18	10523374	missense	probably damaging	0.99
R0478:Greb1l	UTSW	18	10509281	missense	probably damaging	1.00
R0555:Greb1l	UTSW	18	10458781	splice site	probably benign
R0671:Greb1l	UTSW	18	10474303	missense	probably damaging	1.00
R1282:Greb1l	UTSW	18	10547289	missense	probably benign	0.13
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1607:Greb1l	UTSW	18	10529703	missense	possibly damaging	0.85
R1666:Greb1l	UTSW	18	10501080	critical splice donor site	probably null
R1666:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R1720:Greb1l	UTSW	18	10553848	missense	probably benign	0.19
R1808:Greb1l	UTSW	18	10542143	missense	probably benign
R1829:Greb1l	UTSW	18	10509314	missense	probably damaging	1.00
R1897:Greb1l	UTSW	18	10498992	missense	probably benign	0.00
R1967:Greb1l	UTSW	18	10501049	missense	possibly damaging	0.91
R2025:Greb1l	UTSW	18	10515221	missense	possibly damaging	0.71
R2086:Greb1l	UTSW	18	10523281	missense	probably damaging	1.00
R2125:Greb1l	UTSW	18	10511422	missense	probably damaging	0.98
R2139:Greb1l	UTSW	18	10555011	missense	probably damaging	1.00
R2255:Greb1l	UTSW	18	10554857	missense	probably damaging	1.00
R2256:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2257:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2880:Greb1l	UTSW	18	10547288	missense	possibly damaging	0.93
R3623:Greb1l	UTSW	18	10542380	missense	probably damaging	0.99
R3778:Greb1l	UTSW	18	10469444	missense	possibly damaging	0.60
R3975:Greb1l	UTSW	18	10522247	missense	possibly damaging	0.71
R4038:Greb1l	UTSW	18	10515209	missense	possibly damaging	0.93
R4062:Greb1l	UTSW	18	10522150	missense	probably damaging	0.99
R4134:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R4342:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R4600:Greb1l	UTSW	18	10553705	missense	probably damaging	1.00
R4618:Greb1l	UTSW	18	10498965	missense	probably benign	0.00
R4683:Greb1l	UTSW	18	10529563	splice site	probably null
R4686:Greb1l	UTSW	18	10522112	missense	probably damaging	0.98
R4707:Greb1l	UTSW	18	10532922	missense	probably benign	0.02
R4780:Greb1l	UTSW	18	10541792	missense	probably benign	0.00
R4819:Greb1l	UTSW	18	10458358	missense	probably damaging	1.00
R4925:Greb1l	UTSW	18	10547447	missense	possibly damaging	0.79
R4960:Greb1l	UTSW	18	10547306	missense	probably damaging	0.99
R5150:Greb1l	UTSW	18	10555950	frame shift	probably null
R5154:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5269:Greb1l	UTSW	18	10511409	missense	probably benign
R5290:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5310:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5328:Greb1l	UTSW	18	10553720	missense	probably damaging	1.00
R5337:Greb1l	UTSW	18	10509143	missense	probably damaging	1.00
R5393:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5402:Greb1l	UTSW	18	10537169	missense	probably benign	0.26
R5718:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5719:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5720:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5721:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5902:Greb1l	UTSW	18	10538302	missense	probably benign	0.00
R5993:Greb1l	UTSW	18	10544455	missense	probably benign	0.10
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6045:Greb1l	UTSW	18	10547068	missense	probably damaging	1.00
R6063:Greb1l	UTSW	18	10557340	missense	probably damaging	1.00
R6297:Greb1l	UTSW	18	10469494	missense	probably damaging	1.00
R6405:Greb1l	UTSW	18	10501076	missense	probably benign	0.30
R6552:Greb1l	UTSW	18	10541814	missense	probably benign	0.00
R6572:Greb1l	UTSW	18	10522131	missense	probably benign	0.07
R6575:Greb1l	UTSW	18	10547347	missense	possibly damaging	0.88
R6922:Greb1l	UTSW	18	10547482	missense	possibly damaging	0.88
R6957:Greb1l	UTSW	18	10558786	missense	probably benign	0.23
R6962:Greb1l	UTSW	18	10547327	missense	probably damaging	1.00
R7012:Greb1l	UTSW	18	10529707	critical splice donor site	probably null
R7179:Greb1l	UTSW	18	10544576	missense	probably benign	0.00
R7251:Greb1l	UTSW	18	10515319	missense	probably damaging	1.00
R7275:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R7301:Greb1l	UTSW	18	10544970	missense	probably damaging	1.00
R7307:Greb1l	UTSW	18	10538142	missense	probably damaging	0.99
R7455:Greb1l	UTSW	18	10554915	missense	probably damaging	1.00
R7832:Greb1l	UTSW	18	10542056	missense	probably benign	0.38
R7934:Greb1l	UTSW	18	10474371	nonsense	probably null
R8137:Greb1l	UTSW	18	10474357	missense	possibly damaging	0.77
R8138:Greb1l	UTSW	18	10533060	missense	probably benign	0.13
R8208:Greb1l	UTSW	18	10510703	missense	probably damaging	1.00
R8227:Greb1l	UTSW	18	10515371	missense	probably damaging	1.00
R8312:Greb1l	UTSW	18	10511587	intron	probably benign
R8331:Greb1l	UTSW	18	10458706	missense	possibly damaging	0.96
R8364:Greb1l	UTSW	18	10529687	missense	possibly damaging	0.85
R8389:Greb1l	UTSW	18	10529613	missense	probably benign	0.00
R8695:Greb1l	UTSW	18	10544450	missense	probably benign	0.01
R8795:Greb1l	UTSW	18	10553739	missense	probably damaging	0.98
R8836:Greb1l	UTSW	18	10509257	missense	probably benign	0.30
R8862:Greb1l	UTSW	18	10555042	missense	possibly damaging	0.90
R8872:Greb1l	UTSW	18	10529684	missense	probably benign	0.18
R8874:Greb1l	UTSW	18	10544896	missense	probably benign	0.01
R8886:Greb1l	UTSW	18	10553843	missense	probably benign	0.21
R8921:Greb1l	UTSW	18	10541825	missense	probably benign	0.01
R8997:Greb1l	UTSW	18	10510747	missense	probably damaging	1.00
R9015:Greb1l	UTSW	18	10541675	missense	probably benign	0.00
R9018:Greb1l	UTSW	18	10542004	missense	possibly damaging	0.76
R9074:Greb1l	UTSW	18	10532797	missense	probably damaging	1.00
R9074:Greb1l	UTSW	18	10558795	missense	probably damaging	1.00
R9117:Greb1l	UTSW	18	10542422	missense	probably benign	0.31
R9189:Greb1l	UTSW	18	10499983	missense	probably benign
R9332:Greb1l	UTSW	18	10532796	missense	possibly damaging	0.92
R9367:Greb1l	UTSW	18	10522130	missense	probably benign	0.00
R9497:Greb1l	UTSW	18	10458600	missense	probably benign	0.00
R9796:Greb1l	UTSW	18	10538233	missense	possibly damaging	0.69
Z1176:Greb1l	UTSW	18	10515305	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTAACCAGAGTGGCTCATCTCAG -3'
(R):5'- TCAAAGATTCCCAGTCCATGACTC -3'

Sequencing Primer
(F):5'- GCTCATCTCAGTTTGTATAGAATGG -3'
(R):5'- GTCCATGACTCCGGAGAAC -3'

Posted On

2015-07-07