Incidental Mutation 'R4409:Pcdha9'
ID327838
Institutional Source Beutler Lab
Gene Symbol Pcdha9
Ensembl Gene ENSMUSG00000103770
Gene Nameprotocadherin alpha 9
Synonyms
MMRRC Submission 041691-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R4409 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location36997880-37187657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36999145 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 422 (H422Q)
Ref Sequence ENSEMBL: ENSMUSP00000111323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070797] [ENSMUST00000115659] [ENSMUST00000115661] [ENSMUST00000115662] [ENSMUST00000192168] [ENSMUST00000192295] [ENSMUST00000192503] [ENSMUST00000192512] [ENSMUST00000192631] [ENSMUST00000193389] [ENSMUST00000193777] [ENSMUST00000193839] [ENSMUST00000194038] [ENSMUST00000194544] [ENSMUST00000194751] [ENSMUST00000195590]
Predicted Effect probably benign
Transcript: ENSMUST00000070797
SMART Domains Protein: ENSMUSP00000068828
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Pfam:Cadherin_tail 797 931 5.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115659
AA Change: H422Q

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000111323
Gene: ENSMUSG00000103770
AA Change: H422Q

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
CA 75 161 2.46e-2 SMART
CA 185 270 8.1e-20 SMART
CA 294 378 1.69e-22 SMART
CA 402 483 1.52e-24 SMART
CA 507 593 5.68e-24 SMART
CA 624 705 6.69e-12 SMART
transmembrane domain 727 749 N/A INTRINSIC
Pfam:Cadherin_tail 828 962 5.6e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115662
SMART Domains Protein: ENSMUSP00000111326
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 916 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192168
SMART Domains Protein: ENSMUSP00000142293
Gene: ENSMUSG00000103092

DomainStartEndE-ValueType
CA 21 131 2.2e-2 SMART
CA 155 240 2.05e-21 SMART
CA 264 348 8.81e-21 SMART
CA 372 453 2.01e-24 SMART
CA 477 563 1.42e-24 SMART
CA 591 673 1.63e-15 SMART
transmembrane domain 693 715 N/A INTRINSIC
low complexity region 902 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192295
SMART Domains Protein: ENSMUSP00000142103
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 568 5.38e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192503
SMART Domains Protein: ENSMUSP00000141989
Gene: ENSMUSG00000102312

DomainStartEndE-ValueType
low complexity region 11 17 N/A INTRINSIC
CA 42 128 3.78e-2 SMART
CA 152 237 8.94e-22 SMART
CA 261 345 3.74e-24 SMART
CA 369 450 1.09e-25 SMART
CA 474 560 1.42e-24 SMART
CA 588 670 2.96e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 910 934 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192512
SMART Domains Protein: ENSMUSP00000141408
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
low complexity region 915 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192631
SMART Domains Protein: ENSMUSP00000142156
Gene: ENSMUSG00000104318

DomainStartEndE-ValueType
CA 21 131 2.58e-2 SMART
CA 155 240 4.27e-19 SMART
CA 264 348 1.42e-24 SMART
CA 372 453 9.36e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 671 4.03e-6 SMART
transmembrane domain 696 718 N/A INTRINSIC
low complexity region 905 929 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193389
SMART Domains Protein: ENSMUSP00000141459
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193777
SMART Domains Protein: ENSMUSP00000141587
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
low complexity region 914 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193839
SMART Domains Protein: ENSMUSP00000142308
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194038
SMART Domains Protein: ENSMUSP00000142159
Gene: ENSMUSG00000103800

DomainStartEndE-ValueType
CA 20 131 6.34e-2 SMART
CA 155 240 4.27e-19 SMART
CA 264 348 2.04e-25 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 9.88e-24 SMART
CA 594 676 8.62e-15 SMART
transmembrane domain 699 721 N/A INTRINSIC
low complexity region 914 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194751
SMART Domains Protein: ENSMUSP00000142285
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
Pfam:Cadherin_2 29 112 4.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195590
SMART Domains Protein: ENSMUSP00000141355
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A C 12: 118,872,922 L1085V probably damaging Het
Adgrf5 T C 17: 43,441,847 V560A probably damaging Het
Ambp C A 4: 63,152,647 S65I probably damaging Het
Ash1l A G 3: 89,007,199 D1712G probably damaging Het
Capn7 T C 14: 31,355,339 L338P probably damaging Het
Car2 T A 3: 14,895,102 S105T probably damaging Het
Casr A G 16: 36,500,341 C482R probably benign Het
Ccdc18 C T 5: 108,220,842 Q1277* probably null Het
Clca1 A G 3: 145,006,027 F736L probably damaging Het
Col6a1 T C 10: 76,721,500 H206R probably benign Het
Crybg1 C T 10: 43,998,758 A785T possibly damaging Het
Cyp2c68 T A 19: 39,739,452 E85D probably damaging Het
Dnah9 T C 11: 66,085,477 S1249G possibly damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fbxw24 A T 9: 109,608,188 D210E probably damaging Het
Fcgr1 T C 3: 96,284,577 Y305C probably benign Het
Gm10226 G T 17: 21,691,969 C37F possibly damaging Het
Gm13178 A T 4: 144,721,302 S35T possibly damaging Het
Gm8909 T A 17: 36,165,850 H244L possibly damaging Het
Greb1l A G 18: 10,503,182 Y411C possibly damaging Het
Grin1 T C 2: 25,310,439 N224D possibly damaging Het
Ighmbp2 C T 19: 3,271,536 V408I probably benign Het
Il1rap G A 16: 26,712,265 probably null Het
Iqcg A G 16: 33,045,518 probably null Het
Klhdc3 C T 17: 46,677,018 G249E probably damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Macrod2 T G 2: 140,418,857 H68Q possibly damaging Het
Morn4 T C 19: 42,078,547 T2A possibly damaging Het
Msc G C 1: 14,755,678 P24R probably damaging Het
Msh5 T C 17: 35,039,250 D300G probably damaging Het
Myo10 A G 15: 25,807,869 Y1859C probably damaging Het
Nacc1 A G 8: 84,673,044 *515Q probably null Het
Olfr1378 T A 11: 50,969,396 I126N probably damaging Het
Olfr722 T A 14: 49,895,773 T10S probably benign Het
Olfr998 T C 2: 85,590,930 L130S probably damaging Het
Oxgr1 C T 14: 120,022,160 V212M possibly damaging Het
P3h2 G C 16: 26,105,290 R132G possibly damaging Het
Pcdhga12 A G 18: 37,768,085 T657A probably damaging Het
Pcx A G 19: 4,610,003 K442R possibly damaging Het
Pkd2 T C 5: 104,466,884 silent Het
Plg T G 17: 12,390,263 C152G probably damaging Het
Plk4 A G 3: 40,806,549 E438G probably damaging Het
Ryr3 A G 2: 112,730,308 L3016P probably damaging Het
Sdccag8 T G 1: 176,868,366 probably null Het
Slc24a1 A T 9: 64,948,224 M467K probably benign Het
Sorl1 T G 9: 42,035,448 I856L probably damaging Het
Spag7 T C 11: 70,664,862 D83G probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmprss11b T C 5: 86,664,278 N170S probably benign Het
Tnfrsf1b G A 4: 145,224,285 Q253* probably null Het
Trim12a G A 7: 104,306,994 A113V probably benign Het
Ttn A G 2: 76,897,643 probably benign Het
Vmn1r213 A C 13: 23,011,423 probably benign Het
Vmn1r54 C A 6: 90,269,882 Y259* probably null Het
Vmn1r55 A G 7: 5,147,076 V116A probably benign Het
Vmn2r120 T C 17: 57,509,477 N626S probably damaging Het
Vmn2r58 A G 7: 41,872,627 F15S possibly damaging Het
Vmn2r73 A T 7: 85,871,560 V400E probably damaging Het
Zbtb39 A G 10: 127,742,827 I423M possibly damaging Het
Zfp352 A G 4: 90,225,164 N514D probably benign Het
Zfp451 A T 1: 33,777,413 H485Q probably damaging Het
Other mutations in Pcdha9
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0761:Pcdha9 UTSW 18 36999963 nonsense probably null
R2985:Pcdha9 UTSW 18 36998202 missense possibly damaging 0.88
R3926:Pcdha9 UTSW 18 36999412 missense probably damaging 1.00
R4049:Pcdha9 UTSW 18 36997942 missense probably benign 0.16
R4816:Pcdha9 UTSW 18 36999458 missense probably damaging 1.00
R4905:Pcdha9 UTSW 18 36998892 missense probably damaging 0.96
R4991:Pcdha9 UTSW 18 36998345 missense probably damaging 0.99
R5484:Pcdha9 UTSW 18 36998103 missense probably damaging 1.00
R5487:Pcdha9 UTSW 18 36999650 missense probably damaging 1.00
R5617:Pcdha9 UTSW 18 36998816 missense probably benign 0.03
R5637:Pcdha9 UTSW 18 36998373 missense probably benign 0.00
R5694:Pcdha9 UTSW 18 36998372 missense probably benign 0.00
R5975:Pcdha9 UTSW 18 36999111 missense probably benign 0.00
R6089:Pcdha9 UTSW 18 36998498 missense probably benign 0.00
R6176:Pcdha9 UTSW 18 36998931 missense probably benign 0.24
R6220:Pcdha9 UTSW 18 36998478 missense probably damaging 1.00
R6238:Pcdha9 UTSW 18 36998975 missense probably benign 0.43
R6391:Pcdha9 UTSW 18 36997919 missense probably benign 0.12
R6622:Pcdha9 UTSW 18 36998654 missense possibly damaging 0.84
R6720:Pcdha9 UTSW 18 36998069 missense probably damaging 0.99
R7239:Pcdha9 UTSW 18 36998498 missense probably benign 0.06
R7624:Pcdha9 UTSW 18 36999796 nonsense probably null
R7721:Pcdha9 UTSW 18 36999636 missense probably benign
Z1177:Pcdha9 UTSW 18 36998214 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGATGCTACAGATAAAGGATACCC -3'
(R):5'- CAGGAGCATTGTCGTTCACG -3'

Sequencing Primer
(F):5'- AGGATACCCACCTATGGTTGC -3'
(R):5'- GAGCATTGTCGTTCACGTCAGC -3'
Posted On2015-07-07