Incidental Mutation 'R4410:Olfr1189'
ID327845
Institutional Source Beutler Lab
Gene Symbol Olfr1189
Ensembl Gene ENSMUSG00000068808
Gene Nameolfactory receptor 1189
SynonymsGA_x6K02T2Q125-50079044-50079964, MOR237-2
MMRRC Submission 041692-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R4410 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88586454-88592762 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 88592421 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 206 (V206I)
Ref Sequence ENSEMBL: ENSMUSP00000149696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090700] [ENSMUST00000213679]
Predicted Effect probably benign
Transcript: ENSMUST00000090700
AA Change: V206I

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000088201
Gene: ENSMUSG00000068808
AA Change: V206I

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 9.6e-42 PFAM
Pfam:7tm_1 39 285 4.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213679
AA Change: V206I

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.1196 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap39 A T 15: 76,725,512 probably benign Het
Arrb1 G T 7: 99,598,296 probably benign Het
Cadps A G 14: 12,822,323 M139T probably damaging Het
Casr A G 16: 36,500,341 C482R probably benign Het
Cdca4 A T 12: 112,821,879 H76Q probably benign Het
Ddias A G 7: 92,858,079 L876P probably benign Het
Dnah9 T C 11: 66,085,477 S1249G possibly damaging Het
Dnttip1 A G 2: 164,767,819 probably benign Het
Eme2 A G 17: 24,893,624 S160P probably benign Het
Fbxw24 A T 9: 109,608,188 D210E probably damaging Het
Folr2 T C 7: 101,840,674 E129G probably damaging Het
Gm7682 A T 5: 94,445,861 Q15L probably benign Het
Herc6 T A 6: 57,659,679 N793K possibly damaging Het
Iqcg T G 16: 33,030,816 K262Q possibly damaging Het
Lhfpl3 A G 5: 22,775,692 probably benign Het
Lmod2 A C 6: 24,604,630 S535R probably damaging Het
Lrp1b T A 2: 40,665,082 S342C possibly damaging Het
Lrrn3 T A 12: 41,452,584 Y578F possibly damaging Het
Map3k4 T A 17: 12,248,998 R1050W probably damaging Het
Mpp6 C T 6: 50,198,268 Q520* probably null Het
Muc6 T A 7: 141,637,663 T2301S possibly damaging Het
Mycbp2 T C 14: 103,135,266 E4048G probably damaging Het
Myh3 G C 11: 67,085,032 E297Q possibly damaging Het
Nkain3 A G 4: 20,778,284 V11A probably benign Het
P3h2 G C 16: 26,105,290 R132G possibly damaging Het
Phgdh A G 3: 98,314,275 M447T probably benign Het
Pmfbp1 G A 8: 109,532,063 A667T probably benign Het
Psmd2 T G 16: 20,655,026 C230G probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc37a3 T A 6: 39,338,813 Y443F probably benign Het
Sorl1 C A 9: 42,003,992 G1314* probably null Het
Spag7 T C 11: 70,664,862 D83G probably damaging Het
St7 C T 6: 17,854,933 R267* probably null Het
Syne2 C T 12: 76,094,393 S99L probably damaging Het
Tacc2 T G 7: 130,742,211 S2533R possibly damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Uaca T G 9: 60,869,891 V518G probably damaging Het
Usp43 T C 11: 67,855,890 E992G probably benign Het
Vmn1r55 A G 7: 5,147,076 V116A probably benign Het
Wdr3 G A 3: 100,140,227 T844M probably benign Het
Wdr7 T A 18: 63,778,249 M904K probably damaging Het
Zbtb39 A G 10: 127,742,827 I423M possibly damaging Het
Zmym1 A T 4: 127,048,104 C830* probably null Het
Other mutations in Olfr1189
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02306:Olfr1189 APN 2 88592606 missense probably benign 0.22
R0115:Olfr1189 UTSW 2 88592655 missense probably damaging 1.00
R0481:Olfr1189 UTSW 2 88592655 missense probably damaging 1.00
R0565:Olfr1189 UTSW 2 88592009 missense probably benign 0.39
R1106:Olfr1189 UTSW 2 88592011 missense probably benign 0.01
R1501:Olfr1189 UTSW 2 88592148 missense possibly damaging 0.94
R1616:Olfr1189 UTSW 2 88592008 missense probably damaging 0.99
R1763:Olfr1189 UTSW 2 88592436 missense probably benign 0.02
R1847:Olfr1189 UTSW 2 88592172 missense probably damaging 1.00
R1989:Olfr1189 UTSW 2 88592599 missense probably damaging 0.99
R3436:Olfr1189 UTSW 2 88592104 missense probably damaging 1.00
R3500:Olfr1189 UTSW 2 88591941 missense probably damaging 1.00
R4463:Olfr1189 UTSW 2 88592632 missense possibly damaging 0.77
R5005:Olfr1189 UTSW 2 88592004 missense probably benign 0.00
R5174:Olfr1189 UTSW 2 88592648 missense probably damaging 1.00
R5557:Olfr1189 UTSW 2 88592553 missense probably damaging 1.00
R6354:Olfr1189 UTSW 2 88592134 missense probably damaging 1.00
R6850:Olfr1189 UTSW 2 88592306 nonsense probably null
R7522:Olfr1189 UTSW 2 88592661 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AAATGATGACTCCTAGGGTGTGC -3'
(R):5'- ATTGGGAATGTCACCACAGG -3'

Sequencing Primer
(F):5'- AGCTTGGGTAGGAGGATCTATGC -3'
(R):5'- TGTCACCACAGGCCTCATATATAAG -3'
Posted On2015-07-07