Mutagenetix > Incidental Mutation

Incidental Mutation 'R4410:Uaca'

327866

Institutional Source

Beutler Lab

Gene Symbol

Uaca

Ensembl Gene

ENSMUSG00000034485

Gene Name

uveal autoantigen with coiled-coil domains and ankyrin repeats

Synonyms

2700059D02Rik, nucling

MMRRC Submission

041692-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.155) question?

Stock #

R4410 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

60794542-60880370 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 60869891 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 518 (V518G)

Ref Sequence

ENSEMBL: ENSMUSP00000151172 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050183] [ENSMUST00000214354]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000050183
AA Change: V520G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000062047
Gene: ENSMUSG00000034485
AA Change: V520G

Domain	Start	End	E-Value	Type
low complexity region	13	31	N/A	INTRINSIC
ANK	35	68	2.66e3	SMART
ANK	69	98	1.96e-3	SMART
ANK	102	131	1.65e-1	SMART
ANK	135	164	1.38e-3	SMART
ANK	168	197	3.65e-3	SMART
ANK	201	230	6.26e-2	SMART
Blast:ANK	234	263	7e-9	BLAST
coiled coil region	301	381	N/A	INTRINSIC
coiled coil region	445	626	N/A	INTRINSIC
Pfam:TolA_bind_tri	869	943	4e-11	PFAM
coiled coil region	1009	1382	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000214354
AA Change: V518G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214997

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216574

Predicted Effect

unknown
Transcript: ENSMUST00000217656
AA Change: V512G

Meta Mutation Damage Score

0.2243

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

96% (46/48)

MGI Phenotype

PHENOTYPE: Homozygous mice display swelling of and inflammatory lesions in the preputial gland. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgap39	A	T	15: 76,725,512		probably benign	Het
Arrb1	G	T	7: 99,598,296		probably benign	Het
Cadps	A	G	14: 12,822,323	M139T	probably damaging	Het
Casr	A	G	16: 36,500,341	C482R	probably benign	Het
Cdca4	A	T	12: 112,821,879	H76Q	probably benign	Het
Ddias	A	G	7: 92,858,079	L876P	probably benign	Het
Dnah9	T	C	11: 66,085,477	S1249G	possibly damaging	Het
Dnttip1	A	G	2: 164,767,819		probably benign	Het
Eme2	A	G	17: 24,893,624	S160P	probably benign	Het
Fbxw24	A	T	9: 109,608,188	D210E	probably damaging	Het
Folr2	T	C	7: 101,840,674	E129G	probably damaging	Het
Gm7682	A	T	5: 94,445,861	Q15L	probably benign	Het
Herc6	T	A	6: 57,659,679	N793K	possibly damaging	Het
Iqcg	T	G	16: 33,030,816	K262Q	possibly damaging	Het
Lhfpl3	A	G	5: 22,775,692		probably benign	Het
Lmod2	A	C	6: 24,604,630	S535R	probably damaging	Het
Lrp1b	T	A	2: 40,665,082	S342C	possibly damaging	Het
Lrrn3	T	A	12: 41,452,584	Y578F	possibly damaging	Het
Map3k4	T	A	17: 12,248,998	R1050W	probably damaging	Het
Mpp6	C	T	6: 50,198,268	Q520*	probably null	Het
Muc6	T	A	7: 141,637,663	T2301S	possibly damaging	Het
Mycbp2	T	C	14: 103,135,266	E4048G	probably damaging	Het
Myh3	G	C	11: 67,085,032	E297Q	possibly damaging	Het
Nkain3	A	G	4: 20,778,284	V11A	probably benign	Het
Olfr1189	G	A	2: 88,592,421	V206I	probably benign	Het
P3h2	G	C	16: 26,105,290	R132G	possibly damaging	Het
Phgdh	A	G	3: 98,314,275	M447T	probably benign	Het
Pmfbp1	G	A	8: 109,532,063	A667T	probably benign	Het
Psmd2	T	G	16: 20,655,026	C230G	probably damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Slc37a3	T	A	6: 39,338,813	Y443F	probably benign	Het
Sorl1	C	A	9: 42,003,992	G1314*	probably null	Het
Spag7	T	C	11: 70,664,862	D83G	probably damaging	Het
St7	C	T	6: 17,854,933	R267*	probably null	Het
Syne2	C	T	12: 76,094,393	S99L	probably damaging	Het
Tacc2	T	G	7: 130,742,211	S2533R	possibly damaging	Het
Tmem59l	A	G	8: 70,487,301	L6S	unknown	Het
Usp43	T	C	11: 67,855,890	E992G	probably benign	Het
Vmn1r55	A	G	7: 5,147,076	V116A	probably benign	Het
Wdr3	G	A	3: 100,140,227	T844M	probably benign	Het
Wdr7	T	A	18: 63,778,249	M904K	probably damaging	Het
Zbtb39	A	G	10: 127,742,827	I423M	possibly damaging	Het
Zmym1	A	T	4: 127,048,104	C830*	probably null	Het

Other mutations in Uaca

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01310:Uaca	APN	9	60872225	missense	probably benign
IGL01751:Uaca	APN	9	60869857	missense	probably damaging	1.00
IGL02868:Uaca	APN	9	60863637	missense	probably damaging	1.00
IGL02977:Uaca	APN	9	60866380	missense	probably benign	0.00
IGL03037:Uaca	APN	9	60840865	missense	probably damaging	1.00
IGL03060:Uaca	APN	9	60869866	missense	probably damaging	1.00
IGL03083:Uaca	APN	9	60863663	missense	probably benign	0.28
IGL03266:Uaca	APN	9	60863407	missense	probably damaging	1.00
IGL03346:Uaca	APN	9	60854318	missense	probably damaging	1.00
Ixtapa	UTSW	9	60870413	missense	probably damaging	0.99
oaxaca	UTSW	9	60871451	missense	probably benign
R0408:Uaca	UTSW	9	60871859	missense	possibly damaging	0.71
R0567:Uaca	UTSW	9	60871381	missense	probably benign	0.01
R0598:Uaca	UTSW	9	60870921	nonsense	probably null
R0603:Uaca	UTSW	9	60871097	missense	possibly damaging	0.60
R0655:Uaca	UTSW	9	60872029	missense	probably benign	0.03
R0707:Uaca	UTSW	9	60848618	splice site	probably benign
R0791:Uaca	UTSW	9	60872059	missense	possibly damaging	0.50
R1466:Uaca	UTSW	9	60854321	missense	possibly damaging	0.88
R1466:Uaca	UTSW	9	60854321	missense	possibly damaging	0.88
R1520:Uaca	UTSW	9	60871381	missense	probably benign	0.30
R1673:Uaca	UTSW	9	60872156	missense	probably damaging	1.00
R1894:Uaca	UTSW	9	60870436	missense	possibly damaging	0.87
R1997:Uaca	UTSW	9	60870341	missense	probably damaging	1.00
R2042:Uaca	UTSW	9	60869891	missense	probably damaging	1.00
R2095:Uaca	UTSW	9	60840843	missense	probably benign	0.00
R2148:Uaca	UTSW	9	60869679	missense	probably damaging	1.00
R2384:Uaca	UTSW	9	60869917	missense	probably damaging	1.00
R3110:Uaca	UTSW	9	60871499	missense	probably damaging	1.00
R3112:Uaca	UTSW	9	60871499	missense	probably damaging	1.00
R4001:Uaca	UTSW	9	60871084	missense	probably benign	0.04
R4155:Uaca	UTSW	9	60871753	missense	probably benign	0.02
R4156:Uaca	UTSW	9	60871753	missense	probably benign	0.02
R4157:Uaca	UTSW	9	60871753	missense	probably benign	0.02
R4674:Uaca	UTSW	9	60854429	missense	possibly damaging	0.94
R4871:Uaca	UTSW	9	60846001	missense	probably damaging	1.00
R5130:Uaca	UTSW	9	60880228	missense	probably damaging	0.96
R5328:Uaca	UTSW	9	60870532	missense	probably benign	0.44
R5358:Uaca	UTSW	9	60871148	missense	probably benign
R5415:Uaca	UTSW	9	60870139	missense	possibly damaging	0.65
R5437:Uaca	UTSW	9	60871451	missense	probably benign
R5647:Uaca	UTSW	9	60872098	missense	probably benign	0.28
R5710:Uaca	UTSW	9	60871811	missense	probably damaging	1.00
R5920:Uaca	UTSW	9	60869603	missense	probably benign	0.19
R5931:Uaca	UTSW	9	60872012	missense	probably damaging	0.97
R5933:Uaca	UTSW	9	60840956	missense	probably damaging	1.00
R5959:Uaca	UTSW	9	60870770	missense	probably damaging	1.00
R6193:Uaca	UTSW	9	60870044	missense	probably damaging	0.99
R6195:Uaca	UTSW	9	60870044	missense	probably damaging	0.99
R6242:Uaca	UTSW	9	60870044	missense	probably damaging	0.99
R6243:Uaca	UTSW	9	60870044	missense	probably damaging	0.99
R6244:Uaca	UTSW	9	60870044	missense	probably damaging	0.99
R6274:Uaca	UTSW	9	60850291	splice site	probably null
R6670:Uaca	UTSW	9	60872024	missense	probably benign	0.09
R6883:Uaca	UTSW	9	60869891	missense	probably damaging	1.00
R7011:Uaca	UTSW	9	60870368	missense	probably damaging	1.00
R7111:Uaca	UTSW	9	60871838	missense	probably benign	0.06
R7146:Uaca	UTSW	9	60870413	missense	probably damaging	0.99
R7424:Uaca	UTSW	9	60870110	missense	probably damaging	1.00
R7485:Uaca	UTSW	9	60846000	missense	probably damaging	1.00
R7510:Uaca	UTSW	9	60850205	splice site	probably null
R7688:Uaca	UTSW	9	60874127	missense	probably benign	0.11
R7724:Uaca	UTSW	9	60869905	missense	probably benign	0.24
R7743:Uaca	UTSW	9	60876395	missense	probably damaging	0.99
R8556:Uaca	UTSW	9	60870641	missense	probably damaging	0.97
R8699:Uaca	UTSW	9	60871065	missense	probably damaging	1.00
R8814:Uaca	UTSW	9	60866398	missense	possibly damaging	0.82
R8828:Uaca	UTSW	9	60871570	missense	probably benign	0.00
R9475:Uaca	UTSW	9	60872216	missense	possibly damaging	0.88
R9477:Uaca	UTSW	9	60870826	missense	probably benign	0.33
R9509:Uaca	UTSW	9	60872216	missense	possibly damaging	0.88
X0067:Uaca	UTSW	9	60859149	missense	possibly damaging	0.69
Z1177:Uaca	UTSW	9	60874123	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACAGGACCGACTGAAGTTC -3'
(R):5'- ACTTCACATGTGCCGCATTC -3'

Sequencing Primer
(F):5'- GTTCCAAAACGAACTGGCTC -3'
(R):5'- TTGAACTCTCCCACCAGCATC -3'

Posted On

2015-07-07