Incidental Mutation 'R4410:Fbxw24'
ID327867
Institutional Source Beutler Lab
Gene Symbol Fbxw24
Ensembl Gene ENSMUSG00000062275
Gene NameF-box and WD-40 domain protein 24
SynonymsGm5162
MMRRC Submission 041692-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R4410 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location109601116-109626057 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 109608188 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 210 (D210E)
Ref Sequence ENSEMBL: ENSMUSP00000073617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073962]
Predicted Effect probably damaging
Transcript: ENSMUST00000073962
AA Change: D210E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000073617
Gene: ENSMUSG00000062275
AA Change: D210E

DomainStartEndE-ValueType
FBOX 8 45 3.25e-4 SMART
SCOP:d1gxra_ 87 227 8e-7 SMART
Blast:WD40 137 176 1e-6 BLAST
Meta Mutation Damage Score 0.1937 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 96% (46/48)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap39 A T 15: 76,725,512 probably benign Het
Arrb1 G T 7: 99,598,296 probably benign Het
Cadps A G 14: 12,822,323 M139T probably damaging Het
Casr A G 16: 36,500,341 C482R probably benign Het
Cdca4 A T 12: 112,821,879 H76Q probably benign Het
Ddias A G 7: 92,858,079 L876P probably benign Het
Dnah9 T C 11: 66,085,477 S1249G possibly damaging Het
Dnttip1 A G 2: 164,767,819 probably benign Het
Eme2 A G 17: 24,893,624 S160P probably benign Het
Folr2 T C 7: 101,840,674 E129G probably damaging Het
Gm7682 A T 5: 94,445,861 Q15L probably benign Het
Herc6 T A 6: 57,659,679 N793K possibly damaging Het
Iqcg T G 16: 33,030,816 K262Q possibly damaging Het
Lhfpl3 A G 5: 22,775,692 probably benign Het
Lmod2 A C 6: 24,604,630 S535R probably damaging Het
Lrp1b T A 2: 40,665,082 S342C possibly damaging Het
Lrrn3 T A 12: 41,452,584 Y578F possibly damaging Het
Map3k4 T A 17: 12,248,998 R1050W probably damaging Het
Mpp6 C T 6: 50,198,268 Q520* probably null Het
Muc6 T A 7: 141,637,663 T2301S possibly damaging Het
Mycbp2 T C 14: 103,135,266 E4048G probably damaging Het
Myh3 G C 11: 67,085,032 E297Q possibly damaging Het
Nkain3 A G 4: 20,778,284 V11A probably benign Het
Olfr1189 G A 2: 88,592,421 V206I probably benign Het
P3h2 G C 16: 26,105,290 R132G possibly damaging Het
Phgdh A G 3: 98,314,275 M447T probably benign Het
Pmfbp1 G A 8: 109,532,063 A667T probably benign Het
Psmd2 T G 16: 20,655,026 C230G probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc37a3 T A 6: 39,338,813 Y443F probably benign Het
Sorl1 C A 9: 42,003,992 G1314* probably null Het
Spag7 T C 11: 70,664,862 D83G probably damaging Het
St7 C T 6: 17,854,933 R267* probably null Het
Syne2 C T 12: 76,094,393 S99L probably damaging Het
Tacc2 T G 7: 130,742,211 S2533R possibly damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Uaca T G 9: 60,869,891 V518G probably damaging Het
Usp43 T C 11: 67,855,890 E992G probably benign Het
Vmn1r55 A G 7: 5,147,076 V116A probably benign Het
Wdr3 G A 3: 100,140,227 T844M probably benign Het
Wdr7 T A 18: 63,778,249 M904K probably damaging Het
Zbtb39 A G 10: 127,742,827 I423M possibly damaging Het
Zmym1 A T 4: 127,048,104 C830* probably null Het
Other mutations in Fbxw24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01093:Fbxw24 APN 9 109604973 missense probably benign 0.00
IGL01373:Fbxw24 APN 9 109623633 missense probably damaging 0.98
IGL01996:Fbxw24 APN 9 109605372 missense possibly damaging 0.84
IGL02179:Fbxw24 APN 9 109609905 nonsense probably null
IGL02718:Fbxw24 APN 9 109624790 missense possibly damaging 0.55
IGL02936:Fbxw24 APN 9 109624958 splice site probably null
IGL03010:Fbxw24 APN 9 109623610 missense probably benign 0.07
IGL03350:Fbxw24 APN 9 109607013 missense probably damaging 1.00
IGL03402:Fbxw24 APN 9 109601248 missense probably damaging 1.00
R0140:Fbxw24 UTSW 9 109605414 missense possibly damaging 0.73
R0718:Fbxw24 UTSW 9 109623509 splice site probably benign
R1166:Fbxw24 UTSW 9 109606998 missense probably benign 0.00
R1550:Fbxw24 UTSW 9 109607044 missense probably benign 0.00
R1950:Fbxw24 UTSW 9 109605413 missense probably benign 0.02
R1986:Fbxw24 UTSW 9 109607056 missense probably damaging 0.97
R2244:Fbxw24 UTSW 9 109605049 missense possibly damaging 0.66
R3683:Fbxw24 UTSW 9 109608042 missense possibly damaging 0.51
R4324:Fbxw24 UTSW 9 109604945 critical splice donor site probably null
R4387:Fbxw24 UTSW 9 109609985 missense probably damaging 1.00
R4409:Fbxw24 UTSW 9 109608188 missense probably damaging 1.00
R4803:Fbxw24 UTSW 9 109624842 missense probably benign 0.02
R5571:Fbxw24 UTSW 9 109606998 missense probably benign 0.00
R6042:Fbxw24 UTSW 9 109607011 missense probably benign 0.09
R6523:Fbxw24 UTSW 9 109604980 nonsense probably null
R6799:Fbxw24 UTSW 9 109624930 missense probably damaging 1.00
R7122:Fbxw24 UTSW 9 109601260 missense probably benign 0.03
R7239:Fbxw24 UTSW 9 109605530 missense possibly damaging 0.71
R7405:Fbxw24 UTSW 9 109607068 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TGGATATCCCTGAGAACCTTCC -3'
(R):5'- AACCCCAGTTCTAGAGAGCC -3'

Sequencing Primer
(F):5'- TCCAGTCTTCACCATTACTAGAAAAG -3'
(R):5'- CCAGTTCTAGAGAGCCTTGTTTCATG -3'
Posted On2015-07-07