Mutagenetix > Incidental Mutation

Incidental Mutation 'R4410:Lrrn3'

327873

Institutional Source

Beutler Lab

Gene Symbol

Lrrn3

Ensembl Gene

ENSMUSG00000036295

Gene Name

leucine rich repeat protein 3, neuronal

Synonyms

NLRR-3

MMRRC Submission

041692-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.203) question?

Stock #

R4410 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

41451668-41486431 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 41452584 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 578 (Y578F)

Ref Sequence

ENSEMBL: ENSMUSP00000043818 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043884] [ENSMUST00000132121] [ENSMUST00000134965]

AlphaFold

Q8CBC6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043884
AA Change: Y578F

PolyPhen 2 Score 0.739 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000043818
Gene: ENSMUSG00000036295
AA Change: Y578F

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
LRRNT	28	73	9.17e-4	SMART
LRR	115	138	2.63e0	SMART
LRR_TYP	139	162	1.5e-4	SMART
LRR	163	186	7.55e-1	SMART
LRR	187	210	1.76e1	SMART
LRR	211	234	1.62e1	SMART
LRR	235	258	5.11e0	SMART
LRR	260	282	3.18e1	SMART
LRR	333	356	4.44e0	SMART
LRRCT	368	420	3.7e-5	SMART
IGc2	435	503	5.04e-9	SMART
FN3	521	602	3.49e0	SMART
transmembrane domain	626	648	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000132121

SMART Domains

Protein: ENSMUSP00000118779
Gene: ENSMUSG00000056899

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S24	38	115	7.7e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000134965

SMART Domains

Protein: ENSMUSP00000116441
Gene: ENSMUSG00000056899

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S24	38	114	6.4e-11	PFAM

Meta Mutation Damage Score

0.1290

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

96% (46/48)

MGI Phenotype

PHENOTYPE: Homozygous null mutant mice exhibited increased mean percent body fat and male homozygous mutant mice exhibited enhanced glucose tolerance when compared with controls. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgap39	A	T	15: 76,725,512		probably benign	Het
Arrb1	G	T	7: 99,598,296		probably benign	Het
Cadps	A	G	14: 12,822,323	M139T	probably damaging	Het
Casr	A	G	16: 36,500,341	C482R	probably benign	Het
Cdca4	A	T	12: 112,821,879	H76Q	probably benign	Het
Ddias	A	G	7: 92,858,079	L876P	probably benign	Het
Dnah9	T	C	11: 66,085,477	S1249G	possibly damaging	Het
Dnttip1	A	G	2: 164,767,819		probably benign	Het
Eme2	A	G	17: 24,893,624	S160P	probably benign	Het
Fbxw24	A	T	9: 109,608,188	D210E	probably damaging	Het
Folr2	T	C	7: 101,840,674	E129G	probably damaging	Het
Gm7682	A	T	5: 94,445,861	Q15L	probably benign	Het
Herc6	T	A	6: 57,659,679	N793K	possibly damaging	Het
Iqcg	T	G	16: 33,030,816	K262Q	possibly damaging	Het
Lhfpl3	A	G	5: 22,775,692		probably benign	Het
Lmod2	A	C	6: 24,604,630	S535R	probably damaging	Het
Lrp1b	T	A	2: 40,665,082	S342C	possibly damaging	Het
Map3k4	T	A	17: 12,248,998	R1050W	probably damaging	Het
Mpp6	C	T	6: 50,198,268	Q520*	probably null	Het
Muc6	T	A	7: 141,637,663	T2301S	possibly damaging	Het
Mycbp2	T	C	14: 103,135,266	E4048G	probably damaging	Het
Myh3	G	C	11: 67,085,032	E297Q	possibly damaging	Het
Nkain3	A	G	4: 20,778,284	V11A	probably benign	Het
Olfr1189	G	A	2: 88,592,421	V206I	probably benign	Het
P3h2	G	C	16: 26,105,290	R132G	possibly damaging	Het
Phgdh	A	G	3: 98,314,275	M447T	probably benign	Het
Pmfbp1	G	A	8: 109,532,063	A667T	probably benign	Het
Psmd2	T	G	16: 20,655,026	C230G	probably damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Slc37a3	T	A	6: 39,338,813	Y443F	probably benign	Het
Sorl1	C	A	9: 42,003,992	G1314*	probably null	Het
Spag7	T	C	11: 70,664,862	D83G	probably damaging	Het
St7	C	T	6: 17,854,933	R267*	probably null	Het
Syne2	C	T	12: 76,094,393	S99L	probably damaging	Het
Tacc2	T	G	7: 130,742,211	S2533R	possibly damaging	Het
Tmem59l	A	G	8: 70,487,301	L6S	unknown	Het
Uaca	T	G	9: 60,869,891	V518G	probably damaging	Het
Usp43	T	C	11: 67,855,890	E992G	probably benign	Het
Vmn1r55	A	G	7: 5,147,076	V116A	probably benign	Het
Wdr3	G	A	3: 100,140,227	T844M	probably benign	Het
Wdr7	T	A	18: 63,778,249	M904K	probably damaging	Het
Zbtb39	A	G	10: 127,742,827	I423M	possibly damaging	Het
Zmym1	A	T	4: 127,048,104	C830*	probably null	Het

Other mutations in Lrrn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00434:Lrrn3	APN	12	41452192	intron	probably benign
IGL02825:Lrrn3	APN	12	41452593	missense	probably damaging	1.00
IGL02927:Lrrn3	APN	12	41453344	missense	probably damaging	1.00
IGL02970:Lrrn3	APN	12	41452360	missense	probably benign
IGL02995:Lrrn3	APN	12	41452217	missense	probably damaging	1.00
IGL02999:Lrrn3	APN	12	41452751	missense	probably benign	0.01
IGL03182:Lrrn3	APN	12	41454021	missense	probably damaging	1.00
IGL03280:Lrrn3	APN	12	41454147	missense	probably damaging	0.97
PIT4469001:Lrrn3	UTSW	12	41453018	missense	probably benign	0.03
R0167:Lrrn3	UTSW	12	41454015	missense	probably damaging	1.00
R0414:Lrrn3	UTSW	12	41453940	missense	probably damaging	1.00
R0787:Lrrn3	UTSW	12	41454231	missense	probably damaging	1.00
R0894:Lrrn3	UTSW	12	41454034	missense	probably damaging	1.00
R1433:Lrrn3	UTSW	12	41452584	missense	possibly damaging	0.74
R1610:Lrrn3	UTSW	12	41452993	missense	possibly damaging	0.89
R1834:Lrrn3	UTSW	12	41453518	missense	probably damaging	1.00
R2068:Lrrn3	UTSW	12	41452996	missense	probably damaging	1.00
R2871:Lrrn3	UTSW	12	41452723	missense	probably benign	0.00
R2871:Lrrn3	UTSW	12	41452723	missense	probably benign	0.00
R3771:Lrrn3	UTSW	12	41452870	missense	probably damaging	1.00
R4408:Lrrn3	UTSW	12	41454042	missense	probably benign	0.04
R4684:Lrrn3	UTSW	12	41454244	missense	possibly damaging	0.75
R4770:Lrrn3	UTSW	12	41452443	missense	probably benign	0.08
R4927:Lrrn3	UTSW	12	41453125	missense	probably damaging	1.00
R5037:Lrrn3	UTSW	12	41453595	missense	probably damaging	1.00
R5482:Lrrn3	UTSW	12	41452387	missense	probably benign	0.01
R5482:Lrrn3	UTSW	12	41452388	missense	probably damaging	0.96
R5667:Lrrn3	UTSW	12	41452298	missense	possibly damaging	0.77
R6022:Lrrn3	UTSW	12	41453430	missense	probably damaging	0.96
R6087:Lrrn3	UTSW	12	41453535	missense	possibly damaging	0.84
R6129:Lrrn3	UTSW	12	41453788	nonsense	probably null
R6309:Lrrn3	UTSW	12	41453206	missense	probably damaging	1.00
R7449:Lrrn3	UTSW	12	41453488	missense	probably damaging	1.00
R7555:Lrrn3	UTSW	12	41452911	missense	probably benign	0.01
R7560:Lrrn3	UTSW	12	41452713	missense	possibly damaging	0.93
R8059:Lrrn3	UTSW	12	41454217	missense	probably benign	0.22
R8134:Lrrn3	UTSW	12	41453048	missense	probably damaging	1.00
R8798:Lrrn3	UTSW	12	41453175	missense	possibly damaging	0.61
R9308:Lrrn3	UTSW	12	41453946	missense	probably damaging	1.00
R9318:Lrrn3	UTSW	12	41453244	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGAAGGCCTCCAACACAGG -3'
(R):5'- ACCTAGTCGGTGCTGATTTG -3'

Sequencing Primer
(F):5'- CAGGCCACAAATACTGTATGATTC -3'
(R):5'- CTGTTCCTCAGGATAATAATGGGTC -3'

Posted On

2015-07-07