Mutagenetix > Incidental Mutation

Incidental Mutation 'R4410:Cadps'

327876

Institutional Source

Beutler Lab

Gene Symbol

Cadps

Ensembl Gene

ENSMUSG00000054423

Gene Name

Ca2+-dependent secretion activator

Synonyms

CAPS1

MMRRC Submission

041692-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4410 (G1)

Quality Score

177

Status

Validated

Chromosome

Chromosomal Location

12372563-12823079 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 12822323 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 139 (M139T)

Ref Sequence

ENSEMBL: ENSMUSP00000136076 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067491] [ENSMUST00000112657] [ENSMUST00000112658] [ENSMUST00000177814] [ENSMUST00000224882]

AlphaFold

Q80TJ1

Predicted Effect

probably damaging
Transcript: ENSMUST00000067491
AA Change: M139T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000064706
Gene: ENSMUSG00000054423
AA Change: M139T

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	41	75	N/A	INTRINSIC
coiled coil region	93	121	N/A	INTRINSIC
C2	397	492	1.08e-2	SMART
PH	520	624	1.78e-10	SMART
low complexity region	772	783	N/A	INTRINSIC
DUF1041	833	948	6.21e-54	SMART
low complexity region	1022	1045	N/A	INTRINSIC
low complexity region	1354	1361	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112657
AA Change: M139T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000108276
Gene: ENSMUSG00000054423
AA Change: M139T

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	41	75	N/A	INTRINSIC
coiled coil region	93	121	N/A	INTRINSIC
C2	397	492	1.08e-2	SMART
PH	520	624	1.78e-10	SMART
low complexity region	775	786	N/A	INTRINSIC
DUF1041	836	941	3.88e-55	SMART
low complexity region	1015	1038	N/A	INTRINSIC
low complexity region	1347	1354	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112658
AA Change: M139T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000108277
Gene: ENSMUSG00000054423
AA Change: M139T

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	41	75	N/A	INTRINSIC
coiled coil region	93	121	N/A	INTRINSIC
C2	397	492	1.08e-2	SMART
PH	520	624	1.78e-10	SMART
low complexity region	776	787	N/A	INTRINSIC
DUF1041	837	942	3.88e-55	SMART
low complexity region	1016	1039	N/A	INTRINSIC
low complexity region	1348	1355	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000177814
AA Change: M139T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000136076
Gene: ENSMUSG00000054423
AA Change: M139T

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	41	75	N/A	INTRINSIC
coiled coil region	93	121	N/A	INTRINSIC
C2	397	492	1.08e-2	SMART
PH	520	624	1.78e-10	SMART
low complexity region	777	788	N/A	INTRINSIC
DUF1041	838	943	2.75e-55	SMART
low complexity region	1017	1040	N/A	INTRINSIC
low complexity region	1349	1356	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000224882
AA Change: M139T

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)

Meta Mutation Damage Score

0.3328

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

96% (46/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a novel neural/endocrine-specific cytosolic and peripheral membrane protein required for the Ca2+-regulated exocytosis of secretory vesicles. The protein acts at a stage in exocytosis that follows ATP-dependent priming, which involves the essential synthesis of phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2). Alternative splicing has been observed at this locus and three variants, encoding distinct isoforms, are described. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous null mice display neonatal lethality, respiratory failure and abnormal adrenal gland physiology. Adult heterozygous null mice display abnormal adrenal gland physiology that is different from that seen in homozygous neonates. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgap39	A	T	15: 76,725,512		probably benign	Het
Arrb1	G	T	7: 99,598,296		probably benign	Het
Casr	A	G	16: 36,500,341	C482R	probably benign	Het
Cdca4	A	T	12: 112,821,879	H76Q	probably benign	Het
Ddias	A	G	7: 92,858,079	L876P	probably benign	Het
Dnah9	T	C	11: 66,085,477	S1249G	possibly damaging	Het
Dnttip1	A	G	2: 164,767,819		probably benign	Het
Eme2	A	G	17: 24,893,624	S160P	probably benign	Het
Fbxw24	A	T	9: 109,608,188	D210E	probably damaging	Het
Folr2	T	C	7: 101,840,674	E129G	probably damaging	Het
Gm7682	A	T	5: 94,445,861	Q15L	probably benign	Het
Herc6	T	A	6: 57,659,679	N793K	possibly damaging	Het
Iqcg	T	G	16: 33,030,816	K262Q	possibly damaging	Het
Lhfpl3	A	G	5: 22,775,692		probably benign	Het
Lmod2	A	C	6: 24,604,630	S535R	probably damaging	Het
Lrp1b	T	A	2: 40,665,082	S342C	possibly damaging	Het
Lrrn3	T	A	12: 41,452,584	Y578F	possibly damaging	Het
Map3k4	T	A	17: 12,248,998	R1050W	probably damaging	Het
Mpp6	C	T	6: 50,198,268	Q520*	probably null	Het
Muc6	T	A	7: 141,637,663	T2301S	possibly damaging	Het
Mycbp2	T	C	14: 103,135,266	E4048G	probably damaging	Het
Myh3	G	C	11: 67,085,032	E297Q	possibly damaging	Het
Nkain3	A	G	4: 20,778,284	V11A	probably benign	Het
Olfr1189	G	A	2: 88,592,421	V206I	probably benign	Het
P3h2	G	C	16: 26,105,290	R132G	possibly damaging	Het
Phgdh	A	G	3: 98,314,275	M447T	probably benign	Het
Pmfbp1	G	A	8: 109,532,063	A667T	probably benign	Het
Psmd2	T	G	16: 20,655,026	C230G	probably damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Slc37a3	T	A	6: 39,338,813	Y443F	probably benign	Het
Sorl1	C	A	9: 42,003,992	G1314*	probably null	Het
Spag7	T	C	11: 70,664,862	D83G	probably damaging	Het
St7	C	T	6: 17,854,933	R267*	probably null	Het
Syne2	C	T	12: 76,094,393	S99L	probably damaging	Het
Tacc2	T	G	7: 130,742,211	S2533R	possibly damaging	Het
Tmem59l	A	G	8: 70,487,301	L6S	unknown	Het
Uaca	T	G	9: 60,869,891	V518G	probably damaging	Het
Usp43	T	C	11: 67,855,890	E992G	probably benign	Het
Vmn1r55	A	G	7: 5,147,076	V116A	probably benign	Het
Wdr3	G	A	3: 100,140,227	T844M	probably benign	Het
Wdr7	T	A	18: 63,778,249	M904K	probably damaging	Het
Zbtb39	A	G	10: 127,742,827	I423M	possibly damaging	Het
Zmym1	A	T	4: 127,048,104	C830*	probably null	Het

Other mutations in Cadps

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00926:Cadps	APN	14	12491795	missense	probably damaging	1.00
IGL00990:Cadps	APN	14	12715374	missense	possibly damaging	0.56
IGL01071:Cadps	APN	14	12509091	splice site	probably null
IGL01339:Cadps	APN	14	12486543	missense	possibly damaging	0.58
IGL01518:Cadps	APN	14	12522352	missense	probably damaging	1.00
IGL01560:Cadps	APN	14	12491792	missense	probably damaging	1.00
IGL01598:Cadps	APN	14	12522202	critical splice donor site	probably null
IGL01603:Cadps	APN	14	12454154	splice site	probably benign
IGL01836:Cadps	APN	14	12522311	missense	probably damaging	1.00
IGL01839:Cadps	APN	14	12467184	splice site	probably benign
IGL01932:Cadps	APN	14	12373609	utr 3 prime	probably benign
IGL02172:Cadps	APN	14	12705681	missense	probably damaging	1.00
IGL02175:Cadps	APN	14	12467092	missense	probably damaging	0.96
IGL02212:Cadps	APN	14	12522345	missense	possibly damaging	0.94
IGL02351:Cadps	APN	14	12597380	missense	probably damaging	0.99
IGL02358:Cadps	APN	14	12597380	missense	probably damaging	0.99
IGL02499:Cadps	APN	14	12822725	nonsense	probably null
IGL02505:Cadps	APN	14	12449759	missense	probably damaging	1.00
IGL02591:Cadps	APN	14	12473465	missense	probably damaging	1.00
IGL02592:Cadps	APN	14	12473465	missense	probably damaging	1.00
IGL02671:Cadps	APN	14	12491824	missense	probably damaging	1.00
IGL02956:Cadps	APN	14	12418047	splice site	probably benign
IGL03029:Cadps	APN	14	12376675	missense	probably damaging	1.00
IGL03216:Cadps	APN	14	12439944	missense	probably damaging	1.00
IGL03282:Cadps	APN	14	12465856	splice site	probably benign
turbo	UTSW	14	12491800	missense	probably damaging	1.00
R0241:Cadps	UTSW	14	12376675	missense	probably damaging	1.00
R0241:Cadps	UTSW	14	12376675	missense	probably damaging	1.00
R0420:Cadps	UTSW	14	12491800	missense	probably damaging	1.00
R1180:Cadps	UTSW	14	12457836	splice site	probably benign
R1398:Cadps	UTSW	14	12449822	missense	probably damaging	1.00
R1678:Cadps	UTSW	14	12517802	critical splice donor site	probably null
R1792:Cadps	UTSW	14	12449802	missense	possibly damaging	0.93
R1863:Cadps	UTSW	14	12449802	missense	possibly damaging	0.93
R1863:Cadps	UTSW	14	12505796	missense	probably benign	0.09
R1918:Cadps	UTSW	14	12546372	missense	probably damaging	0.99
R1920:Cadps	UTSW	14	12465859	missense	possibly damaging	0.64
R1921:Cadps	UTSW	14	12465859	missense	possibly damaging	0.64
R1922:Cadps	UTSW	14	12465859	missense	possibly damaging	0.64
R1925:Cadps	UTSW	14	12705726	missense	probably damaging	1.00
R1966:Cadps	UTSW	14	12822450	nonsense	probably null
R2013:Cadps	UTSW	14	12522337	missense	probably damaging	1.00
R2228:Cadps	UTSW	14	12465935	missense	probably benign	0.05
R2331:Cadps	UTSW	14	12603692	missense	probably damaging	1.00
R3436:Cadps	UTSW	14	12616158	splice site	probably null
R3853:Cadps	UTSW	14	12509090	splice site	probably benign
R3893:Cadps	UTSW	14	12488883	utr 3 prime	probably benign
R3916:Cadps	UTSW	14	12457702	missense	probably benign	0.00
R3917:Cadps	UTSW	14	12457702	missense	probably benign	0.00
R3953:Cadps	UTSW	14	12505937	missense	probably damaging	1.00
R3966:Cadps	UTSW	14	12522161	splice site	probably null
R4024:Cadps	UTSW	14	12705539	missense	probably damaging	1.00
R4079:Cadps	UTSW	14	12457702	missense	probably benign	0.00
R4230:Cadps	UTSW	14	12488987	missense	probably damaging	0.98
R4333:Cadps	UTSW	14	12467031	missense	probably damaging	1.00
R4586:Cadps	UTSW	14	12505808	missense	probably damaging	1.00
R4685:Cadps	UTSW	14	12467139	missense	possibly damaging	0.77
R4698:Cadps	UTSW	14	12705654	missense	possibly damaging	0.90
R4855:Cadps	UTSW	14	12822449	missense	unknown
R4898:Cadps	UTSW	14	12411588	missense	possibly damaging	0.86
R4908:Cadps	UTSW	14	12536386	missense	probably damaging	1.00
R5208:Cadps	UTSW	14	12457711	missense	possibly damaging	0.68
R5297:Cadps	UTSW	14	12822345	missense	probably damaging	1.00
R5328:Cadps	UTSW	14	12457790	missense	probably benign	0.31
R5408:Cadps	UTSW	14	12705759	missense	possibly damaging	0.87
R5529:Cadps	UTSW	14	12454285	missense	probably damaging	1.00
R5567:Cadps	UTSW	14	12473497	missense	possibly damaging	0.49
R5570:Cadps	UTSW	14	12473497	missense	possibly damaging	0.49
R5727:Cadps	UTSW	14	12486525	nonsense	probably null
R5812:Cadps	UTSW	14	12376685	missense	probably benign
R6361:Cadps	UTSW	14	12491778	nonsense	probably null
R6767:Cadps	UTSW	14	12550888	missense	probably damaging	1.00
R6805:Cadps	UTSW	14	12467103	missense	probably damaging	0.99
R6861:Cadps	UTSW	14	12522401	nonsense	probably null
R6883:Cadps	UTSW	14	12465883	missense	probably damaging	0.96
R6887:Cadps	UTSW	14	12505811	missense	probably damaging	1.00
R6997:Cadps	UTSW	14	12505793	missense	possibly damaging	0.88
R7102:Cadps	UTSW	14	12603738	missense	probably damaging	1.00
R7120:Cadps	UTSW	14	12439919	missense	probably damaging	0.98
R7143:Cadps	UTSW	14	12491838	missense	probably benign	0.02
R7290:Cadps	UTSW	14	12616099	missense	probably damaging	1.00
R7614:Cadps	UTSW	14	12454260	missense	probably damaging	1.00
R7674:Cadps	UTSW	14	12411581	missense	probably damaging	0.99
R7715:Cadps	UTSW	14	12457762	missense	probably benign	0.01
R7801:Cadps	UTSW	14	12489476	critical splice donor site	probably null
R7814:Cadps	UTSW	14	12376706	missense	probably damaging	0.99
R7915:Cadps	UTSW	14	12705544	missense	possibly damaging	0.84
R8087:Cadps	UTSW	14	12536380	missense	probably damaging	1.00
R8109:Cadps	UTSW	14	12488975	missense	probably benign	0.00
R8485:Cadps	UTSW	14	12439872	missense	probably damaging	1.00
R9156:Cadps	UTSW	14	12705676	missense	probably damaging	1.00
R9158:Cadps	UTSW	14	12546356	missense	probably benign	0.10
R9312:Cadps	UTSW	14	12616095	missense	probably damaging	1.00
R9465:Cadps	UTSW	14	12489002	missense	possibly damaging	0.93
R9519:Cadps	UTSW	14	12546290	missense	possibly damaging	0.86
R9649:Cadps	UTSW	14	12597418	missense	probably damaging	0.99
R9662:Cadps	UTSW	14	12411567	missense	probably benign	0.02
R9674:Cadps	UTSW	14	12454291	missense	probably damaging	1.00
X0018:Cadps	UTSW	14	12373690	missense	probably damaging	1.00
X0028:Cadps	UTSW	14	12467118	missense	possibly damaging	0.93
Z1088:Cadps	UTSW	14	12467113	missense	probably damaging	0.96
Z1177:Cadps	UTSW	14	12465880	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACATCTCCCGAGTCAAGCTG -3'
(R):5'- TGACCTAGGAAGAAGCGCCTAC -3'

Sequencing Primer
(F):5'- AGTCAAGCTGGGCGGTG -3'
(R):5'- TTTTGCACCCCAAGGCG -3'

Posted On

2015-07-07