Mutagenetix > Incidental Mutation

Incidental Mutation 'R4410:Arhgap39'

327878

Institutional Source

Beutler Lab

Gene Symbol

Arhgap39

Ensembl Gene

ENSMUSG00000033697

Gene Name

Rho GTPase activating protein 39

Synonyms

D15Wsu169e

MMRRC Submission

041692-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.276) question?

Stock #

R4410 (G1)

Quality Score

114

Status

Validated

Chromosome

Chromosomal Location

76723985-76818170 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

A to T at 76725512 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000155349 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036176] [ENSMUST00000036247] [ENSMUST00000049956] [ENSMUST00000077821] [ENSMUST00000228990]

AlphaFold

P59281

Predicted Effect

probably benign
Transcript: ENSMUST00000036176

SMART Domains

Protein: ENSMUSP00000036697
Gene: ENSMUSG00000033697

Domain	Start	End	E-Value	Type
WW	27	60	1.64e0	SMART
WW	66	99	5.41e-1	SMART
low complexity region	125	138	N/A	INTRINSIC
low complexity region	304	318	N/A	INTRINSIC
Pfam:MyTH4	759	904	2.3e-32	PFAM
RhoGAP	932	1105	5.9e-28	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000036247

SMART Domains

Protein: ENSMUSP00000039910
Gene: ENSMUSG00000116138

Domain	Start	End	E-Value	Type
Pfam:DUF4505	31	209	5.4e-84	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000049956

SMART Domains

Protein: ENSMUSP00000061906
Gene: ENSMUSG00000033707

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
LRRNT	30	62	1.04e-2	SMART
LRR	61	80	3.18e2	SMART
LRR_TYP	81	104	2.99e-4	SMART
LRR	106	128	3.87e1	SMART
LRR_TYP	129	152	8.22e-2	SMART
LRR_TYP	153	176	5.06e-2	SMART
LRR	177	200	2.02e-1	SMART
LRRCT	212	266	2e-10	SMART
IGc2	280	360	1.02e-9	SMART
transmembrane domain	409	431	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000077821

SMART Domains

Protein: ENSMUSP00000076993
Gene: ENSMUSG00000033697

Domain	Start	End	E-Value	Type
WW	27	60	1.64e0	SMART
WW	66	99	5.41e-1	SMART
low complexity region	125	138	N/A	INTRINSIC
low complexity region	304	318	N/A	INTRINSIC
Pfam:MyTH4	756	874	3.3e-25	PFAM
RhoGAP	901	1074	5.9e-28	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146725

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176724

Predicted Effect

probably benign
Transcript: ENSMUST00000228990

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229507

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230372

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230559

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231059

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

96% (46/48)

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arrb1	G	T	7: 99,598,296		probably benign	Het
Cadps	A	G	14: 12,822,323	M139T	probably damaging	Het
Casr	A	G	16: 36,500,341	C482R	probably benign	Het
Cdca4	A	T	12: 112,821,879	H76Q	probably benign	Het
Ddias	A	G	7: 92,858,079	L876P	probably benign	Het
Dnah9	T	C	11: 66,085,477	S1249G	possibly damaging	Het
Dnttip1	A	G	2: 164,767,819		probably benign	Het
Eme2	A	G	17: 24,893,624	S160P	probably benign	Het
Fbxw24	A	T	9: 109,608,188	D210E	probably damaging	Het
Folr2	T	C	7: 101,840,674	E129G	probably damaging	Het
Gm7682	A	T	5: 94,445,861	Q15L	probably benign	Het
Herc6	T	A	6: 57,659,679	N793K	possibly damaging	Het
Iqcg	T	G	16: 33,030,816	K262Q	possibly damaging	Het
Lhfpl3	A	G	5: 22,775,692		probably benign	Het
Lmod2	A	C	6: 24,604,630	S535R	probably damaging	Het
Lrp1b	T	A	2: 40,665,082	S342C	possibly damaging	Het
Lrrn3	T	A	12: 41,452,584	Y578F	possibly damaging	Het
Map3k4	T	A	17: 12,248,998	R1050W	probably damaging	Het
Mpp6	C	T	6: 50,198,268	Q520*	probably null	Het
Muc6	T	A	7: 141,637,663	T2301S	possibly damaging	Het
Mycbp2	T	C	14: 103,135,266	E4048G	probably damaging	Het
Myh3	G	C	11: 67,085,032	E297Q	possibly damaging	Het
Nkain3	A	G	4: 20,778,284	V11A	probably benign	Het
Olfr1189	G	A	2: 88,592,421	V206I	probably benign	Het
P3h2	G	C	16: 26,105,290	R132G	possibly damaging	Het
Phgdh	A	G	3: 98,314,275	M447T	probably benign	Het
Pmfbp1	G	A	8: 109,532,063	A667T	probably benign	Het
Psmd2	T	G	16: 20,655,026	C230G	probably damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Slc37a3	T	A	6: 39,338,813	Y443F	probably benign	Het
Sorl1	C	A	9: 42,003,992	G1314*	probably null	Het
Spag7	T	C	11: 70,664,862	D83G	probably damaging	Het
St7	C	T	6: 17,854,933	R267*	probably null	Het
Syne2	C	T	12: 76,094,393	S99L	probably damaging	Het
Tacc2	T	G	7: 130,742,211	S2533R	possibly damaging	Het
Tmem59l	A	G	8: 70,487,301	L6S	unknown	Het
Uaca	T	G	9: 60,869,891	V518G	probably damaging	Het
Usp43	T	C	11: 67,855,890	E992G	probably benign	Het
Vmn1r55	A	G	7: 5,147,076	V116A	probably benign	Het
Wdr3	G	A	3: 100,140,227	T844M	probably benign	Het
Wdr7	T	A	18: 63,778,249	M904K	probably damaging	Het
Zbtb39	A	G	10: 127,742,827	I423M	possibly damaging	Het
Zmym1	A	T	4: 127,048,104	C830*	probably null	Het

Other mutations in Arhgap39

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01547:Arhgap39	APN	15	76737815	splice site	probably benign
IGL01586:Arhgap39	APN	15	76730438	missense	probably benign	0.16
IGL01693:Arhgap39	APN	15	76725967	missense	probably null	1.00
IGL02017:Arhgap39	APN	15	76737037	missense	probably damaging	0.98
IGL02508:Arhgap39	APN	15	76724984	makesense	probably null
IGL03333:Arhgap39	APN	15	76726732	missense	probably benign	0.05
R0328:Arhgap39	UTSW	15	76751952	splice site	probably benign
R0432:Arhgap39	UTSW	15	76734886	missense	probably damaging	0.99
R0479:Arhgap39	UTSW	15	76734886	missense	probably damaging	0.99
R0549:Arhgap39	UTSW	15	76734886	missense	probably damaging	0.99
R0551:Arhgap39	UTSW	15	76734886	missense	probably damaging	0.99
R1054:Arhgap39	UTSW	15	76751559	missense	probably benign
R1830:Arhgap39	UTSW	15	76735183	missense	probably damaging	1.00
R2421:Arhgap39	UTSW	15	76725146	missense	probably damaging	1.00
R2497:Arhgap39	UTSW	15	76725385	missense	probably damaging	1.00
R3909:Arhgap39	UTSW	15	76751888	missense	probably benign	0.03
R4626:Arhgap39	UTSW	15	76737637	missense	possibly damaging	0.92
R4790:Arhgap39	UTSW	15	76726731	missense	possibly damaging	0.51
R4792:Arhgap39	UTSW	15	76741517	missense	possibly damaging	0.92
R4911:Arhgap39	UTSW	15	76737805	missense	probably damaging	1.00
R5225:Arhgap39	UTSW	15	76725515	unclassified	probably benign
R5417:Arhgap39	UTSW	15	76735101	missense	possibly damaging	0.80
R5443:Arhgap39	UTSW	15	76797925	intron	probably benign
R5521:Arhgap39	UTSW	15	76765494	missense	possibly damaging	0.66
R5686:Arhgap39	UTSW	15	76726633	missense	probably damaging	1.00
R5747:Arhgap39	UTSW	15	76741535	missense	possibly damaging	0.68
R5785:Arhgap39	UTSW	15	76737418	missense	probably benign
R5879:Arhgap39	UTSW	15	76751807	missense	probably damaging	1.00
R6035:Arhgap39	UTSW	15	76737224	nonsense	probably null
R6035:Arhgap39	UTSW	15	76737224	nonsense	probably null
R6049:Arhgap39	UTSW	15	76727401	critical splice donor site	probably null
R6143:Arhgap39	UTSW	15	76730406	nonsense	probably null
R6232:Arhgap39	UTSW	15	76736512	missense	probably damaging	1.00
R6276:Arhgap39	UTSW	15	76737536	missense	probably benign	0.06
R6277:Arhgap39	UTSW	15	76735137	missense	probably damaging	1.00
R6305:Arhgap39	UTSW	15	76737702	missense	probably benign	0.31
R6587:Arhgap39	UTSW	15	76737499	missense	probably damaging	1.00
R7153:Arhgap39	UTSW	15	76765491	missense	probably benign	0.09
R7447:Arhgap39	UTSW	15	76765597	start gained	probably benign
R7658:Arhgap39	UTSW	15	76737417	missense	probably benign	0.03
R8071:Arhgap39	UTSW	15	76737502	missense	probably benign
R8269:Arhgap39	UTSW	15	76751742	missense	probably benign	0.35
R8368:Arhgap39	UTSW	15	76735255	missense	probably damaging	1.00
R9124:Arhgap39	UTSW	15	76735267	missense	probably damaging	1.00
R9333:Arhgap39	UTSW	15	76735125	missense	probably damaging	1.00
R9438:Arhgap39	UTSW	15	76751918	missense	probably damaging	0.96
R9602:Arhgap39	UTSW	15	76726754	missense	probably damaging	0.98
R9615:Arhgap39	UTSW	15	76737238	missense	probably benign	0.02
R9700:Arhgap39	UTSW	15	76727417	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ACAGCACCATTCGGTTGATG -3'
(R):5'- ACATCCTCCCACACTGTTGTATAG -3'

Sequencing Primer
(F):5'- CCATTCGGTTGATGCGCGG -3'
(R):5'- TAGCCATTGTGGACACATGC -3'

Posted On

2015-07-07