Mutagenetix > Incidental Mutation

Incidental Mutation 'R4410:Wdr7'

327886

Institutional Source

Beutler Lab

Gene Symbol

Wdr7

Ensembl Gene

ENSMUSG00000040560

Gene Name

WD repeat domain 7

Synonyms

TGF-beta resistance associated gene, TRAG

MMRRC Submission

041692-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.928) question?

Stock #

R4410 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

63708695-63989760 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 63778249 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 904 (M904K)

Ref Sequence

ENSEMBL: ENSMUSP00000072509 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072726]

AlphaFold

Q920I9

Predicted Effect

probably damaging
Transcript: ENSMUST00000072726
AA Change: M904K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000072509
Gene: ENSMUSG00000040560
AA Change: M904K

Domain	Start	End	E-Value	Type
WD40	5	47	1.2e-2	SMART
WD40	53	95	3.71e-1	SMART
Blast:WD40	145	190	1e-18	BLAST
WD40	208	242	1.77e2	SMART
WD40	453	498	3.81e-5	SMART
WD40	501	546	4.26e1	SMART
WD40	549	588	1.63e-4	SMART
low complexity region	760	777	N/A	INTRINSIC
low complexity region	915	927	N/A	INTRINSIC
low complexity region	956	970	N/A	INTRINSIC
low complexity region	1020	1040	N/A	INTRINSIC
low complexity region	1181	1192	N/A	INTRINSIC
Blast:WD40	1341	1380	5e-20	BLAST
WD40	1382	1422	2.73e-6	SMART

Meta Mutation Damage Score

0.8116

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

96% (46/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) that may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. The encoded protein forms the beta subunit of rabconnectin-3 and binds directly with Rab3A GDP/GTP exchange protein and indirectly with Rab3A GDP/GTP activating protein; these proteins are regulators of Rab3 small G protein family members involved in control of the calcium-dependant exocytosis of neurotransmitters. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgap39	A	T	15: 76,725,512		probably benign	Het
Arrb1	G	T	7: 99,598,296		probably benign	Het
Cadps	A	G	14: 12,822,323	M139T	probably damaging	Het
Casr	A	G	16: 36,500,341	C482R	probably benign	Het
Cdca4	A	T	12: 112,821,879	H76Q	probably benign	Het
Ddias	A	G	7: 92,858,079	L876P	probably benign	Het
Dnah9	T	C	11: 66,085,477	S1249G	possibly damaging	Het
Dnttip1	A	G	2: 164,767,819		probably benign	Het
Eme2	A	G	17: 24,893,624	S160P	probably benign	Het
Fbxw24	A	T	9: 109,608,188	D210E	probably damaging	Het
Folr2	T	C	7: 101,840,674	E129G	probably damaging	Het
Gm7682	A	T	5: 94,445,861	Q15L	probably benign	Het
Herc6	T	A	6: 57,659,679	N793K	possibly damaging	Het
Iqcg	T	G	16: 33,030,816	K262Q	possibly damaging	Het
Lhfpl3	A	G	5: 22,775,692		probably benign	Het
Lmod2	A	C	6: 24,604,630	S535R	probably damaging	Het
Lrp1b	T	A	2: 40,665,082	S342C	possibly damaging	Het
Lrrn3	T	A	12: 41,452,584	Y578F	possibly damaging	Het
Map3k4	T	A	17: 12,248,998	R1050W	probably damaging	Het
Mpp6	C	T	6: 50,198,268	Q520*	probably null	Het
Muc6	T	A	7: 141,637,663	T2301S	possibly damaging	Het
Mycbp2	T	C	14: 103,135,266	E4048G	probably damaging	Het
Myh3	G	C	11: 67,085,032	E297Q	possibly damaging	Het
Nkain3	A	G	4: 20,778,284	V11A	probably benign	Het
Olfr1189	G	A	2: 88,592,421	V206I	probably benign	Het
P3h2	G	C	16: 26,105,290	R132G	possibly damaging	Het
Phgdh	A	G	3: 98,314,275	M447T	probably benign	Het
Pmfbp1	G	A	8: 109,532,063	A667T	probably benign	Het
Psmd2	T	G	16: 20,655,026	C230G	probably damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Slc37a3	T	A	6: 39,338,813	Y443F	probably benign	Het
Sorl1	C	A	9: 42,003,992	G1314*	probably null	Het
Spag7	T	C	11: 70,664,862	D83G	probably damaging	Het
St7	C	T	6: 17,854,933	R267*	probably null	Het
Syne2	C	T	12: 76,094,393	S99L	probably damaging	Het
Tacc2	T	G	7: 130,742,211	S2533R	possibly damaging	Het
Tmem59l	A	G	8: 70,487,301	L6S	unknown	Het
Uaca	T	G	9: 60,869,891	V518G	probably damaging	Het
Usp43	T	C	11: 67,855,890	E992G	probably benign	Het
Vmn1r55	A	G	7: 5,147,076	V116A	probably benign	Het
Wdr3	G	A	3: 100,140,227	T844M	probably benign	Het
Zbtb39	A	G	10: 127,742,827	I423M	possibly damaging	Het
Zmym1	A	T	4: 127,048,104	C830*	probably null	Het

Other mutations in Wdr7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00513:Wdr7	APN	18	63720775	missense	possibly damaging	0.83
IGL00708:Wdr7	APN	18	63778033	missense	probably benign	0.42
IGL00813:Wdr7	APN	18	63735604	missense	possibly damaging	0.84
IGL00840:Wdr7	APN	18	63927327	missense	possibly damaging	0.80
IGL00904:Wdr7	APN	18	63796231	missense	probably benign	0.43
IGL00930:Wdr7	APN	18	63740244	nonsense	probably null
IGL01481:Wdr7	APN	18	63739179	missense	probably damaging	1.00
IGL02121:Wdr7	APN	18	63777545	nonsense	probably null
IGL02346:Wdr7	APN	18	63865336	missense	probably benign	0.09
IGL02454:Wdr7	APN	18	63796228	missense	probably benign	0.20
IGL02538:Wdr7	APN	18	63796235	missense	probably benign	0.01
IGL02870:Wdr7	APN	18	63791843	missense	probably benign
IGL03054:Wdr7	APN	18	63825121	splice site	probably benign
IGL03189:Wdr7	APN	18	63760601	missense	probably benign	0.17
R0014:Wdr7	UTSW	18	63904101	missense	probably benign	0.03
R0022:Wdr7	UTSW	18	63777634	missense	probably damaging	1.00
R0233:Wdr7	UTSW	18	63904101	missense	probably benign	0.03
R0432:Wdr7	UTSW	18	63796249	missense	probably damaging	0.96
R0496:Wdr7	UTSW	18	63791843	missense	probably benign
R0633:Wdr7	UTSW	18	63865300	missense	probably benign	0.00
R0931:Wdr7	UTSW	18	63865300	missense	probably benign	0.00
R1585:Wdr7	UTSW	18	63924918	missense	probably benign	0.03
R1651:Wdr7	UTSW	18	63720776	nonsense	probably null
R1804:Wdr7	UTSW	18	63865440	missense	probably damaging	1.00
R1874:Wdr7	UTSW	18	63728504	missense	probably benign	0.02
R1985:Wdr7	UTSW	18	63760583	frame shift	probably null
R2106:Wdr7	UTSW	18	63778038	missense	probably damaging	1.00
R2206:Wdr7	UTSW	18	63777607	missense	possibly damaging	0.95
R2207:Wdr7	UTSW	18	63777607	missense	possibly damaging	0.95
R2245:Wdr7	UTSW	18	63924909	missense	possibly damaging	0.60
R2407:Wdr7	UTSW	18	63760723	missense	probably benign
R3804:Wdr7	UTSW	18	63720836	missense	probably benign
R3880:Wdr7	UTSW	18	63724155	missense	possibly damaging	0.92
R4441:Wdr7	UTSW	18	63755210	missense	probably damaging	1.00
R4485:Wdr7	UTSW	18	63777550	missense	possibly damaging	0.89
R4606:Wdr7	UTSW	18	63779945	nonsense	probably null
R4607:Wdr7	UTSW	18	63777580	missense	probably benign	0.28
R4608:Wdr7	UTSW	18	63777580	missense	probably benign	0.28
R4711:Wdr7	UTSW	18	63728465	missense	probably benign
R4852:Wdr7	UTSW	18	63777949	missense	probably damaging	0.98
R5197:Wdr7	UTSW	18	63738866	missense	probably benign	0.02
R5213:Wdr7	UTSW	18	63755126	missense	probably damaging	1.00
R5280:Wdr7	UTSW	18	63987312	missense	probably benign	0.35
R5378:Wdr7	UTSW	18	63825239	critical splice donor site	probably null
R6076:Wdr7	UTSW	18	63739277	missense	probably damaging	1.00
R6083:Wdr7	UTSW	18	63728469	missense	probably damaging	1.00
R6168:Wdr7	UTSW	18	63777977	missense	probably damaging	0.98
R6234:Wdr7	UTSW	18	63724132	missense	probably damaging	1.00
R6295:Wdr7	UTSW	18	63755111	missense	probably damaging	1.00
R6548:Wdr7	UTSW	18	63778251	missense	possibly damaging	0.87
R6566:Wdr7	UTSW	18	63755055	missense	possibly damaging	0.72
R6696:Wdr7	UTSW	18	63739330	missense	probably benign	0.07
R6937:Wdr7	UTSW	18	63791867	missense	probably benign
R6962:Wdr7	UTSW	18	63865288	missense	possibly damaging	0.74
R7162:Wdr7	UTSW	18	63724139	missense	possibly damaging	0.92
R7376:Wdr7	UTSW	18	63777620	missense	probably damaging	1.00
R7423:Wdr7	UTSW	18	63777380	splice site	probably null
R7781:Wdr7	UTSW	18	63777789	nonsense	probably null
R7851:Wdr7	UTSW	18	63720327	missense	probably benign	0.05
R7962:Wdr7	UTSW	18	63904086	missense	probably damaging	1.00
R8310:Wdr7	UTSW	18	63735685	missense	probably damaging	0.98
R8325:Wdr7	UTSW	18	63778464	splice site	probably null
R8520:Wdr7	UTSW	18	63987160	missense	probably benign	0.09
R8678:Wdr7	UTSW	18	63777697	missense	probably damaging	1.00
R8847:Wdr7	UTSW	18	63739222	missense	probably damaging	1.00
R9326:Wdr7	UTSW	18	63739189	missense	probably benign	0.14
R9443:Wdr7	UTSW	18	63720336	missense	probably damaging	1.00
R9487:Wdr7	UTSW	18	63777868	missense	possibly damaging	0.51
R9652:Wdr7	UTSW	18	63727755	missense	probably damaging	1.00
R9657:Wdr7	UTSW	18	63924847	missense	probably damaging	1.00
R9710:Wdr7	UTSW	18	63794246	missense	possibly damaging	0.76
R9784:Wdr7	UTSW	18	63904165	missense	probably damaging	1.00
R9790:Wdr7	UTSW	18	63777988	missense	probably damaging	1.00
R9791:Wdr7	UTSW	18	63777988	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTCCCGGTTATAATCAGGCTG -3'
(R):5'- TGACCAACTCCTACATTGTAAATCC -3'

Sequencing Primer
(F):5'- CTGCTGGAAAACTGCTGCATG -3'
(R):5'- AATGTCTGTTTTACAGTTGAAATGGG -3'

Posted On

2015-07-07