Incidental Mutation 'R4411:Ttc17'
ID327897
Institutional Source Beutler Lab
Gene Symbol Ttc17
Ensembl Gene ENSMUSG00000027194
Gene Nametetratricopeptide repeat domain 17
SynonymsD2Bwg1005e, 9130020K17Rik
MMRRC Submission 041693-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.693) question?
Stock #R4411 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location94300767-94406689 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94342753 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 766 (K766E)
Ref Sequence ENSEMBL: ENSMUSP00000092395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055081] [ENSMUST00000094801] [ENSMUST00000111237] [ENSMUST00000111238]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055081
AA Change: K193E

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000061360
Gene: ENSMUSG00000027194
AA Change: K193E

DomainStartEndE-ValueType
TPR 46 79 1.33e1 SMART
Blast:TPR 82 115 3e-10 BLAST
TPR 116 149 4.91e-4 SMART
low complexity region 326 344 N/A INTRINSIC
TPR 499 532 2.43e1 SMART
TPR 535 568 6.75e1 SMART
TPR 569 602 6.84e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000094801
AA Change: K766E

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000092395
Gene: ENSMUSG00000027194
AA Change: K766E

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
internal_repeat_1 113 271 7.26e-16 PROSPERO
low complexity region 275 293 N/A INTRINSIC
TPR 295 328 1.39e-3 SMART
coiled coil region 340 382 N/A INTRINSIC
TPR 619 652 1.33e1 SMART
Blast:TPR 655 688 3e-10 BLAST
TPR 689 722 4.91e-4 SMART
low complexity region 899 917 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111237
SMART Domains Protein: ENSMUSP00000106868
Gene: ENSMUSG00000027194

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
Blast:TPR 225 258 8e-11 BLAST
low complexity region 275 293 N/A INTRINSIC
TPR 295 328 1.39e-3 SMART
TPR 619 652 1.33e1 SMART
Blast:TPR 655 688 4e-10 BLAST
TPR 689 722 4.91e-4 SMART
low complexity region 842 860 N/A INTRINSIC
TPR 1015 1048 2.43e1 SMART
TPR 1051 1084 6.75e1 SMART
TPR 1085 1118 6.84e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111238
AA Change: K766E

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106869
Gene: ENSMUSG00000027194
AA Change: K766E

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
internal_repeat_2 113 271 8.31e-15 PROSPERO
low complexity region 275 293 N/A INTRINSIC
TPR 295 328 1.39e-3 SMART
coiled coil region 340 382 N/A INTRINSIC
TPR 619 652 1.33e1 SMART
Blast:TPR 655 688 4e-10 BLAST
TPR 689 722 4.91e-4 SMART
low complexity region 899 917 N/A INTRINSIC
TPR 1072 1105 2.43e1 SMART
TPR 1108 1141 6.75e1 SMART
TPR 1142 1175 6.84e-3 SMART
Meta Mutation Damage Score 0.0645 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 95% (62/65)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,151,955 I423V probably benign Het
Abl2 T C 1: 156,630,082 V306A possibly damaging Het
Adcy4 T C 14: 55,769,443 Y1006C probably damaging Het
Adprhl1 T C 8: 13,246,114 K144E probably benign Het
Arid5b T C 10: 68,096,689 R885G probably damaging Het
Atp9a A T 2: 168,661,933 V613E probably damaging Het
Atxn7l1 G T 12: 33,194,887 probably benign Het
Brd8 C A 18: 34,623,444 probably benign Het
Bsnd C T 4: 106,486,671 R146H probably benign Het
C4b C T 17: 34,728,864 R1659H probably damaging Het
Duox1 G A 2: 122,337,634 R1080H probably benign Het
Eml2 T C 7: 19,182,401 probably null Het
Fbxo44 G A 4: 148,153,608 R221C probably damaging Het
Frem1 T C 4: 82,963,244 D166G probably damaging Het
Galnt5 T C 2: 57,999,195 L269P probably benign Het
Gigyf2 A G 1: 87,436,860 E954G probably damaging Het
Gpc6 T C 14: 117,951,178 V408A probably benign Het
Hspg2 A G 4: 137,562,224 T3832A probably benign Het
Ift88 A G 14: 57,477,979 N493S probably damaging Het
Ighv1-76 A T 12: 115,848,111 C41S probably damaging Het
Igkv12-46 G A 6: 69,764,946 T16I probably benign Het
Igkv3-9 G T 6: 70,588,563 V49F probably damaging Het
Isoc2b A T 7: 4,849,434 probably benign Het
Lcp2 T A 11: 34,087,173 probably benign Het
Lmntd1 A G 6: 145,427,277 probably null Het
Mdm2 A T 10: 117,709,789 probably null Het
Mrgprx3-ps T C 7: 47,309,998 noncoding transcript Het
Msh2 T C 17: 87,717,604 S637P probably damaging Het
Myo5b T C 18: 74,698,274 F765S possibly damaging Het
Nav2 T A 7: 49,398,109 N91K probably benign Het
Ndor1 G A 2: 25,248,480 P363S probably benign Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Pcdhb5 T C 18: 37,321,997 S477P possibly damaging Het
Pde3b GTGATGATGATGATGATGATGATGATG GTGATGATGATGATGATGATGATG 7: 114,534,749 probably benign Het
Pnpla7 G A 2: 25,051,704 W13* probably null Het
Pnpla8 T C 12: 44,283,442 V41A probably benign Het
Prdm2 A T 4: 143,133,670 S1017T probably benign Het
Prdm5 T A 6: 65,901,787 Y108* probably null Het
Rab34 T A 11: 78,188,766 probably null Het
Smpd5 G T 15: 76,294,912 R160L possibly damaging Het
Srrm2 A G 17: 23,810,468 probably benign Het
Taf5 T A 19: 47,071,014 V199D probably damaging Het
Tas2r114 C T 6: 131,689,622 V148I probably benign Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tex43 A G 18: 56,594,648 T65A probably benign Het
Tnfrsf25 G A 4: 152,118,386 probably benign Het
Tpd52l1 T C 10: 31,379,319 T11A possibly damaging Het
Trmt1l G A 1: 151,452,154 E472K probably benign Het
Ttc37 A G 13: 76,127,504 E410G possibly damaging Het
Ttn C T 2: 76,730,289 R29256Q probably damaging Het
Ttn T C 2: 76,742,070 I26160V probably damaging Het
Ubxn6 A T 17: 56,069,303 V311E probably damaging Het
Usp2 T C 9: 44,091,063 S351P probably damaging Het
Usp7 C A 16: 8,708,914 D187Y probably damaging Het
Vmn1r115 C T 7: 20,844,282 R235K probably benign Het
Vmn2r50 A C 7: 10,050,308 F80V probably damaging Het
Vmn2r58 T A 7: 41,861,936 K481M possibly damaging Het
Vmn2r86 A G 10: 130,452,600 I344T possibly damaging Het
Zfp455 A T 13: 67,207,325 N219I probably damaging Het
Other mutations in Ttc17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Ttc17 APN 2 94323083 splice site probably benign
IGL00870:Ttc17 APN 2 94371733 splice site probably null
IGL01120:Ttc17 APN 2 94371796 missense probably damaging 1.00
IGL01845:Ttc17 APN 2 94332832 nonsense probably null
IGL01895:Ttc17 APN 2 94375146 missense possibly damaging 0.80
IGL02064:Ttc17 APN 2 94330667 missense probably damaging 1.00
IGL02296:Ttc17 APN 2 94377710 missense probably damaging 1.00
IGL02309:Ttc17 APN 2 94342661 missense probably benign
IGL02456:Ttc17 APN 2 94362785 splice site probably benign
IGL02475:Ttc17 APN 2 94364376 missense probably damaging 1.00
IGL03341:Ttc17 APN 2 94375221 missense probably damaging 1.00
IGL03371:Ttc17 APN 2 94386105 missense probably damaging 1.00
R0389:Ttc17 UTSW 2 94378094 missense probably benign 0.03
R0443:Ttc17 UTSW 2 94378094 missense probably benign 0.03
R0511:Ttc17 UTSW 2 94323120 missense possibly damaging 0.87
R0763:Ttc17 UTSW 2 94332803 missense probably benign 0.08
R1980:Ttc17 UTSW 2 94326704 missense possibly damaging 0.82
R1981:Ttc17 UTSW 2 94326704 missense possibly damaging 0.82
R1987:Ttc17 UTSW 2 94364345 missense probably benign
R2064:Ttc17 UTSW 2 94366547 missense probably damaging 1.00
R2147:Ttc17 UTSW 2 94301794 missense possibly damaging 0.87
R2155:Ttc17 UTSW 2 94366642 missense possibly damaging 0.88
R2844:Ttc17 UTSW 2 94376074 nonsense probably null
R3719:Ttc17 UTSW 2 94364327 missense probably benign 0.27
R3852:Ttc17 UTSW 2 94369413 missense possibly damaging 0.86
R3947:Ttc17 UTSW 2 94376146 splice site probably benign
R4461:Ttc17 UTSW 2 94366571 missense probably benign 0.02
R4660:Ttc17 UTSW 2 94364429 missense possibly damaging 0.51
R4762:Ttc17 UTSW 2 94371768 missense probably damaging 1.00
R4818:Ttc17 UTSW 2 94332891 missense possibly damaging 0.91
R4819:Ttc17 UTSW 2 94364610 missense probably damaging 1.00
R4864:Ttc17 UTSW 2 94366635 missense probably benign 0.01
R4870:Ttc17 UTSW 2 94366609 missense probably damaging 1.00
R5203:Ttc17 UTSW 2 94378716 missense probably damaging 1.00
R5288:Ttc17 UTSW 2 94303640 missense probably damaging 1.00
R5385:Ttc17 UTSW 2 94303640 missense probably damaging 1.00
R5386:Ttc17 UTSW 2 94303640 missense probably damaging 1.00
R5453:Ttc17 UTSW 2 94303560 missense probably damaging 1.00
R5583:Ttc17 UTSW 2 94377682 missense probably damaging 1.00
R5683:Ttc17 UTSW 2 94362521 missense probably damaging 1.00
R5921:Ttc17 UTSW 2 94378848 missense probably damaging 1.00
R6272:Ttc17 UTSW 2 94358755 missense probably damaging 1.00
R6444:Ttc17 UTSW 2 94303546 missense possibly damaging 0.57
R6748:Ttc17 UTSW 2 94386102 missense probably benign 0.02
R7204:Ttc17 UTSW 2 94362428 missense possibly damaging 0.95
R7300:Ttc17 UTSW 2 94375134 missense probably damaging 1.00
R7446:Ttc17 UTSW 2 94375150 missense probably damaging 0.97
R7680:Ttc17 UTSW 2 94366544 missense probably benign 0.06
R7912:Ttc17 UTSW 2 94378821 missense probably damaging 1.00
R7993:Ttc17 UTSW 2 94378821 missense probably damaging 1.00
X0013:Ttc17 UTSW 2 94330670 missense probably damaging 1.00
X0018:Ttc17 UTSW 2 94378716 missense probably damaging 1.00
X0025:Ttc17 UTSW 2 94324516 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGGAGTTGATTTTCCCACAGAAG -3'
(R):5'- CCTTACAACGGCATAGCAGC -3'

Sequencing Primer
(F):5'- TTTCCCACAGAAGCACAGTTTGG -3'
(R):5'- GTACAAACTTTTGAGCCACGTGC -3'
Posted On2015-07-07