Incidental Mutation 'R4411:Frem1'
ID327900
Institutional Source Beutler Lab
Gene Symbol Frem1
Ensembl Gene ENSMUSG00000059049
Gene NameFras1 related extracellular matrix protein 1
Synonymseyes2, heb, eye, crf11, QBRICK
MMRRC Submission 041693-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.783) question?
Stock #R4411 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location82897920-83052339 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82963244 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 166 (D166G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071708] [ENSMUST00000107230] [ENSMUST00000170248]
Predicted Effect probably benign
Transcript: ENSMUST00000071708
AA Change: D1260G

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000071627
Gene: ENSMUSG00000059049
AA Change: D1260G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Cadherin_3 364 508 1.7e-37 PFAM
Pfam:Cadherin_3 509 623 3.7e-18 PFAM
Pfam:Cadherin_3 592 709 8.4e-16 PFAM
Pfam:Cadherin_3 746 894 4.8e-26 PFAM
Pfam:Cadherin_3 863 1009 2.8e-30 PFAM
Pfam:Cadherin_3 1024 1115 6.4e-13 PFAM
Pfam:Cadherin_3 1119 1252 1.4e-17 PFAM
Pfam:Cadherin_3 1243 1393 8.2e-35 PFAM
Pfam:Cadherin_3 1378 1506 2e-22 PFAM
Pfam:Cadherin_3 1506 1616 1e-29 PFAM
Pfam:Cadherin_3 1617 1744 1.5e-14 PFAM
Pfam:Calx-beta 1749 1848 2.6e-10 PFAM
low complexity region 1894 1910 N/A INTRINSIC
CLECT 2065 2188 2.25e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107230
AA Change: D1241G

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102849
Gene: ENSMUSG00000059049
AA Change: D1241G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
internal_repeat_1 296 967 9.01e-39 PROSPERO
internal_repeat_1 1026 1705 9.01e-39 PROSPERO
Pfam:Calx-beta 1730 1829 6.7e-10 PFAM
low complexity region 1875 1891 N/A INTRINSIC
CLECT 2046 2169 2.25e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127886
AA Change: D166G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122467
Gene: ENSMUSG00000059049
AA Change: D166G

DomainStartEndE-ValueType
Pfam:Cadherin_3 26 158 1.1e-18 PFAM
Pfam:Cadherin_3 150 300 4.6e-36 PFAM
Pfam:Cadherin_3 285 408 6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170248
AA Change: D1242G

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000125809
Gene: ENSMUSG00000059049
AA Change: D1242G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Cadherin_3 365 509 1.3e-37 PFAM
Pfam:Cadherin_3 510 623 4.5e-18 PFAM
Pfam:Cadherin_3 593 711 6.1e-16 PFAM
Pfam:Cadherin_3 728 876 2.7e-27 PFAM
Pfam:Cadherin_3 845 991 2.1e-30 PFAM
Pfam:Cadherin_3 1006 1097 4.8e-13 PFAM
Pfam:Cadherin_3 1101 1234 1e-17 PFAM
Pfam:Cadherin_3 1225 1375 6.1e-35 PFAM
Pfam:Cadherin_3 1360 1488 1.5e-22 PFAM
Pfam:Cadherin_3 1488 1598 7.5e-30 PFAM
Pfam:Cadherin_3 1599 1726 1.1e-14 PFAM
Pfam:Calx-beta 1731 1830 6.4e-10 PFAM
low complexity region 1876 1892 N/A INTRINSIC
CLECT 2047 2170 2.25e-27 SMART
Meta Mutation Damage Score 0.1238 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a basement membrane protein that may play a role in craniofacial and renal development. Mutations in this gene have been associated with bifid nose with or without anorectal and renal anomalies. Alternatively spliced transcript variants encoding different isoforms have been described. PubMed ID 19940113 describes one such variant that initiates transcription within a distinct, internal exon; the resulting shorter isoform (named Toll-like/interleukin-1 receptor regulator, TILRR) is suggested to be a co-receptor of the interleukin 1 receptor family and may regulate receptor function and Toll-like receptor/interleukin 1 receptor signal transduction, contributing to the control of inflammatory response activation. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous mutation of this gene results in subepidermal blistering, cryptophthalmos, syndactyly, and renal agenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,151,955 I423V probably benign Het
Abl2 T C 1: 156,630,082 V306A possibly damaging Het
Adcy4 T C 14: 55,769,443 Y1006C probably damaging Het
Adprhl1 T C 8: 13,246,114 K144E probably benign Het
Arid5b T C 10: 68,096,689 R885G probably damaging Het
Atp9a A T 2: 168,661,933 V613E probably damaging Het
Atxn7l1 G T 12: 33,194,887 probably benign Het
Brd8 C A 18: 34,623,444 probably benign Het
Bsnd C T 4: 106,486,671 R146H probably benign Het
C4b C T 17: 34,728,864 R1659H probably damaging Het
Duox1 G A 2: 122,337,634 R1080H probably benign Het
Eml2 T C 7: 19,182,401 probably null Het
Fbxo44 G A 4: 148,153,608 R221C probably damaging Het
Galnt5 T C 2: 57,999,195 L269P probably benign Het
Gigyf2 A G 1: 87,436,860 E954G probably damaging Het
Gpc6 T C 14: 117,951,178 V408A probably benign Het
Hspg2 A G 4: 137,562,224 T3832A probably benign Het
Ift88 A G 14: 57,477,979 N493S probably damaging Het
Ighv1-76 A T 12: 115,848,111 C41S probably damaging Het
Igkv12-46 G A 6: 69,764,946 T16I probably benign Het
Igkv3-9 G T 6: 70,588,563 V49F probably damaging Het
Isoc2b A T 7: 4,849,434 probably benign Het
Lcp2 T A 11: 34,087,173 probably benign Het
Lmntd1 A G 6: 145,427,277 probably null Het
Mdm2 A T 10: 117,709,789 probably null Het
Mrgprx3-ps T C 7: 47,309,998 noncoding transcript Het
Msh2 T C 17: 87,717,604 S637P probably damaging Het
Myo5b T C 18: 74,698,274 F765S possibly damaging Het
Nav2 T A 7: 49,398,109 N91K probably benign Het
Ndor1 G A 2: 25,248,480 P363S probably benign Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Pcdhb5 T C 18: 37,321,997 S477P possibly damaging Het
Pde3b GTGATGATGATGATGATGATGATGATG GTGATGATGATGATGATGATGATG 7: 114,534,749 probably benign Het
Pnpla7 G A 2: 25,051,704 W13* probably null Het
Pnpla8 T C 12: 44,283,442 V41A probably benign Het
Prdm2 A T 4: 143,133,670 S1017T probably benign Het
Prdm5 T A 6: 65,901,787 Y108* probably null Het
Rab34 T A 11: 78,188,766 probably null Het
Smpd5 G T 15: 76,294,912 R160L possibly damaging Het
Srrm2 A G 17: 23,810,468 probably benign Het
Taf5 T A 19: 47,071,014 V199D probably damaging Het
Tas2r114 C T 6: 131,689,622 V148I probably benign Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tex43 A G 18: 56,594,648 T65A probably benign Het
Tnfrsf25 G A 4: 152,118,386 probably benign Het
Tpd52l1 T C 10: 31,379,319 T11A possibly damaging Het
Trmt1l G A 1: 151,452,154 E472K probably benign Het
Ttc17 T C 2: 94,342,753 K766E probably damaging Het
Ttc37 A G 13: 76,127,504 E410G possibly damaging Het
Ttn C T 2: 76,730,289 R29256Q probably damaging Het
Ttn T C 2: 76,742,070 I26160V probably damaging Het
Ubxn6 A T 17: 56,069,303 V311E probably damaging Het
Usp2 T C 9: 44,091,063 S351P probably damaging Het
Usp7 C A 16: 8,708,914 D187Y probably damaging Het
Vmn1r115 C T 7: 20,844,282 R235K probably benign Het
Vmn2r50 A C 7: 10,050,308 F80V probably damaging Het
Vmn2r58 T A 7: 41,861,936 K481M possibly damaging Het
Vmn2r86 A G 10: 130,452,600 I344T possibly damaging Het
Zfp455 A T 13: 67,207,325 N219I probably damaging Het
Other mutations in Frem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Frem1 APN 4 82959389 missense possibly damaging 0.46
IGL01069:Frem1 APN 4 83013867 missense probably benign 0.00
IGL01106:Frem1 APN 4 82922257 missense probably benign 0.00
IGL01398:Frem1 APN 4 82950362 missense possibly damaging 0.64
IGL01617:Frem1 APN 4 82936139 missense probably benign 0.02
IGL01647:Frem1 APN 4 82950356 missense possibly damaging 0.60
IGL01690:Frem1 APN 4 82959296 splice site probably benign
IGL02006:Frem1 APN 4 82992800 critical splice donor site probably null
IGL02069:Frem1 APN 4 82903551 missense probably damaging 1.00
IGL02131:Frem1 APN 4 82924854 missense probably benign 0.03
IGL02225:Frem1 APN 4 82940506 missense probably damaging 1.00
IGL02439:Frem1 APN 4 82956345 missense probably benign 0.00
IGL02567:Frem1 APN 4 83000055 missense probably damaging 1.00
IGL02647:Frem1 APN 4 83001754 missense probably damaging 1.00
IGL02653:Frem1 APN 4 82959334 missense probably benign 0.22
IGL02831:Frem1 APN 4 82956158 missense probably benign 0.31
IGL02997:Frem1 APN 4 82934968 missense probably damaging 1.00
IGL03005:Frem1 APN 4 82994134 missense probably damaging 1.00
IGL03036:Frem1 APN 4 82959339 missense possibly damaging 0.55
IGL03193:Frem1 APN 4 82994026 splice site probably benign
IGL03218:Frem1 APN 4 82914646 missense probably benign 0.00
IGL03235:Frem1 APN 4 83020755 missense possibly damaging 0.87
IGL03243:Frem1 APN 4 83013969 missense probably damaging 1.00
bat UTSW 4 82983060 intron probably benign
PIT4131001:Frem1 UTSW 4 83005808 missense probably damaging 0.99
PIT4466001:Frem1 UTSW 4 82972137 missense probably benign 0.01
PIT4472001:Frem1 UTSW 4 82972137 missense probably benign 0.01
PIT4515001:Frem1 UTSW 4 82900426 missense probably damaging 0.98
PIT4531001:Frem1 UTSW 4 82950280 missense probably benign 0.12
R0010:Frem1 UTSW 4 83000098 missense probably benign 0.41
R0010:Frem1 UTSW 4 83000098 missense probably benign 0.41
R0115:Frem1 UTSW 4 82936169 missense possibly damaging 0.94
R0125:Frem1 UTSW 4 83011951 missense probably damaging 1.00
R0280:Frem1 UTSW 4 82969444 missense probably damaging 1.00
R0504:Frem1 UTSW 4 82912637 missense probably benign 0.26
R0519:Frem1 UTSW 4 82970633 critical splice donor site probably null
R0631:Frem1 UTSW 4 82972165 missense probably damaging 1.00
R0645:Frem1 UTSW 4 82989166 missense probably damaging 1.00
R0781:Frem1 UTSW 4 82950320 missense probably damaging 0.99
R1110:Frem1 UTSW 4 82950320 missense probably damaging 0.99
R1115:Frem1 UTSW 4 83020770 missense probably benign 0.28
R1130:Frem1 UTSW 4 82916628 splice site probably null
R1173:Frem1 UTSW 4 82950352 missense probably benign 0.16
R1349:Frem1 UTSW 4 82922305 splice site probably benign
R1464:Frem1 UTSW 4 83011879 missense probably damaging 1.00
R1464:Frem1 UTSW 4 83011879 missense probably damaging 1.00
R1658:Frem1 UTSW 4 83001808 missense probably damaging 1.00
R1672:Frem1 UTSW 4 82998891 missense probably benign 0.09
R1831:Frem1 UTSW 4 83020837 missense possibly damaging 0.95
R1851:Frem1 UTSW 4 82950500 missense probably damaging 0.98
R2014:Frem1 UTSW 4 83005852 missense probably damaging 1.00
R2021:Frem1 UTSW 4 82913558 missense probably benign 0.02
R2022:Frem1 UTSW 4 82913558 missense probably benign 0.02
R2023:Frem1 UTSW 4 82913558 missense probably benign 0.02
R2183:Frem1 UTSW 4 82991495 missense probably benign 0.00
R2437:Frem1 UTSW 4 83000173 missense probably damaging 1.00
R2520:Frem1 UTSW 4 82950290 missense probably damaging 0.99
R3195:Frem1 UTSW 4 83014114 missense probably damaging 0.99
R3196:Frem1 UTSW 4 83014114 missense probably damaging 0.99
R3408:Frem1 UTSW 4 83011986 missense probably damaging 1.00
R3411:Frem1 UTSW 4 82963179 missense possibly damaging 0.51
R3742:Frem1 UTSW 4 83011867 missense probably damaging 1.00
R3829:Frem1 UTSW 4 82998930 missense probably damaging 1.00
R3888:Frem1 UTSW 4 82913607 missense probably benign 0.41
R4329:Frem1 UTSW 4 82986537 missense probably benign 0.01
R4364:Frem1 UTSW 4 82913251 missense probably damaging 0.99
R4624:Frem1 UTSW 4 82989106 missense probably damaging 1.00
R4687:Frem1 UTSW 4 83020631 missense probably damaging 1.00
R4764:Frem1 UTSW 4 82989189 missense probably damaging 1.00
R4801:Frem1 UTSW 4 82916628 splice site probably benign
R4802:Frem1 UTSW 4 82916628 splice site probably benign
R4854:Frem1 UTSW 4 82916758 missense possibly damaging 0.88
R4872:Frem1 UTSW 4 82963150 missense probably damaging 1.00
R4947:Frem1 UTSW 4 82966134 missense probably damaging 0.99
R5007:Frem1 UTSW 4 82940812 intron probably benign
R5103:Frem1 UTSW 4 82991612 missense probably benign
R5369:Frem1 UTSW 4 83001739 missense possibly damaging 0.61
R5494:Frem1 UTSW 4 82940753 makesense probably null
R5694:Frem1 UTSW 4 82994116 missense probably damaging 1.00
R5780:Frem1 UTSW 4 82950415 missense probably benign 0.12
R5813:Frem1 UTSW 4 83000158 missense probably damaging 1.00
R5843:Frem1 UTSW 4 82936052 missense probably damaging 1.00
R5914:Frem1 UTSW 4 83001775 missense probably damaging 1.00
R5985:Frem1 UTSW 4 82966050 missense probably benign
R6091:Frem1 UTSW 4 82900559 missense probably benign 0.01
R6165:Frem1 UTSW 4 82956255 missense probably benign 0.16
R6324:Frem1 UTSW 4 82983337 missense probably benign 0.00
R6369:Frem1 UTSW 4 82913792 intron probably null
R6414:Frem1 UTSW 4 82940536 missense probably damaging 0.98
R6421:Frem1 UTSW 4 82994128 missense probably damaging 1.00
R6434:Frem1 UTSW 4 82966016 missense probably benign 0.03
R6453:Frem1 UTSW 4 82914825 nonsense probably null
R6598:Frem1 UTSW 4 83013828 missense probably damaging 0.99
R6720:Frem1 UTSW 4 83013832 missense probably damaging 0.98
R6862:Frem1 UTSW 4 83012014 nonsense probably null
R6922:Frem1 UTSW 4 82922269 missense probably damaging 1.00
R6931:Frem1 UTSW 4 82970677 missense probably damaging 1.00
R6992:Frem1 UTSW 4 82940362 missense possibly damaging 0.62
R6995:Frem1 UTSW 4 82986601 missense probably damaging 1.00
R7001:Frem1 UTSW 4 82986561 missense probably benign 0.44
R7104:Frem1 UTSW 4 82940681 missense probably benign 0.30
R7146:Frem1 UTSW 4 82922295 missense possibly damaging 0.93
R7174:Frem1 UTSW 4 82922256 missense probably benign 0.00
R7327:Frem1 UTSW 4 83020755 missense possibly damaging 0.87
R7343:Frem1 UTSW 4 82994122 missense probably damaging 0.99
R7368:Frem1 UTSW 4 82966144 missense probably benign 0.19
R7392:Frem1 UTSW 4 83013827 missense probably benign 0.06
R7465:Frem1 UTSW 4 82914835 missense probably benign 0.11
R7499:Frem1 UTSW 4 83005770 missense probably damaging 1.00
R7536:Frem1 UTSW 4 82956195 missense probably damaging 1.00
R7752:Frem1 UTSW 4 82959377 missense probably benign 0.02
R7753:Frem1 UTSW 4 82913980 missense probably benign 0.03
R7790:Frem1 UTSW 4 82989164 missense probably benign 0.02
R7818:Frem1 UTSW 4 83014008 missense probably damaging 1.00
R7877:Frem1 UTSW 4 83013812 critical splice donor site probably null
R7878:Frem1 UTSW 4 83020680 missense probably benign 0.00
R7886:Frem1 UTSW 4 83016406 missense possibly damaging 0.68
R7901:Frem1 UTSW 4 82959377 missense probably benign 0.02
R7960:Frem1 UTSW 4 83013812 critical splice donor site probably null
R7961:Frem1 UTSW 4 83020680 missense probably benign 0.00
R7969:Frem1 UTSW 4 83016406 missense possibly damaging 0.68
R7984:Frem1 UTSW 4 82959377 missense probably benign 0.02
X0013:Frem1 UTSW 4 82914808 missense probably benign 0.38
X0017:Frem1 UTSW 4 82991633 critical splice acceptor site probably null
Z1088:Frem1 UTSW 4 82972267 missense probably damaging 1.00
Z1176:Frem1 UTSW 4 82999983 missense probably damaging 1.00
Z1177:Frem1 UTSW 4 82940315 critical splice donor site probably null
Z1177:Frem1 UTSW 4 83000269 missense probably benign 0.39
Z1177:Frem1 UTSW 4 83016464 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTCATAGAAGATGGGATCTGTG -3'
(R):5'- GAGCTTTTGAATGACTCCACAAAAC -3'

Sequencing Primer
(F):5'- TTCTGTGGACCTAGTGTCACAAAAC -3'
(R):5'- TTTTGAATGACTCCACAAAACAGAGC -3'
Posted On2015-07-07