Incidental Mutation 'R4411:Tnfrsf25'
ID327906
Institutional Source Beutler Lab
Gene Symbol Tnfrsf25
Ensembl Gene ENSMUSG00000024793
Gene Nametumor necrosis factor receptor superfamily, member 25
SynonymsDR3, Tnfrsf12, APO-3, TR3, DDR3, WSL-LR, LARD, TRAMP, WSL-1, Wsl
MMRRC Submission 041693-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4411 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location152115934-152120119 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 152118386 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025706] [ENSMUST00000030785] [ENSMUST00000035275] [ENSMUST00000049305] [ENSMUST00000070018] [ENSMUST00000080042] [ENSMUST00000084114] [ENSMUST00000084115] [ENSMUST00000103196] [ENSMUST00000105653] [ENSMUST00000105654] [ENSMUST00000105655] [ENSMUST00000105656] [ENSMUST00000105657] [ENSMUST00000105658] [ENSMUST00000105659] [ENSMUST00000105661] [ENSMUST00000105662] [ENSMUST00000118648]
Predicted Effect probably benign
Transcript: ENSMUST00000025706
SMART Domains Protein: ENSMUSP00000025706
Gene: ENSMUSG00000024793

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
TNFR 38 75 4.12e0 SMART
TNFR 78 120 3.78e-5 SMART
transmembrane domain 196 218 N/A INTRINSIC
DEATH 315 407 6.04e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000030785
SMART Domains Protein: ENSMUSP00000030785
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
ANK 35 64 3.26e0 SMART
ANK 69 99 1.15e0 SMART
ANK 103 133 2.58e-3 SMART
ANK 137 167 1.63e0 SMART
ANK 171 201 4.97e-5 SMART
ANK 205 235 3.08e-1 SMART
ANK 239 268 9.13e-4 SMART
ANK 271 300 2.15e0 SMART
ANK 304 334 2.08e3 SMART
low complexity region 377 395 N/A INTRINSIC
low complexity region 428 465 N/A INTRINSIC
low complexity region 605 629 N/A INTRINSIC
WH2 669 686 4.82e-3 SMART
low complexity region 714 728 N/A INTRINSIC
low complexity region 740 748 N/A INTRINSIC
coiled coil region 772 848 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000035275
SMART Domains Protein: ENSMUSP00000047823
Gene: ENSMUSG00000024793

DomainStartEndE-ValueType
signal peptide 1 43 N/A INTRINSIC
TNFR 51 88 4.12e0 SMART
TNFR 91 133 3.78e-5 SMART
transmembrane domain 172 194 N/A INTRINSIC
DEATH 291 383 6.04e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000049305
SMART Domains Protein: ENSMUSP00000037982
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
WH2 26 43 4.82e-3 SMART
low complexity region 96 110 N/A INTRINSIC
low complexity region 122 130 N/A INTRINSIC
coiled coil region 154 230 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070018
SMART Domains Protein: ENSMUSP00000065545
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 101 138 N/A INTRINSIC
low complexity region 267 291 N/A INTRINSIC
low complexity region 304 313 N/A INTRINSIC
WH2 322 339 4.82e-3 SMART
low complexity region 367 381 N/A INTRINSIC
low complexity region 393 401 N/A INTRINSIC
SCOP:d1eq1a_ 432 499 4e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080042
SMART Domains Protein: ENSMUSP00000078951
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 101 138 N/A INTRINSIC
low complexity region 186 210 N/A INTRINSIC
WH2 250 267 4.82e-3 SMART
low complexity region 295 309 N/A INTRINSIC
low complexity region 321 329 N/A INTRINSIC
SCOP:d1eq1a_ 360 427 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084114
SMART Domains Protein: ENSMUSP00000081131
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 101 138 N/A INTRINSIC
low complexity region 267 291 N/A INTRINSIC
WH2 331 348 4.82e-3 SMART
low complexity region 376 390 N/A INTRINSIC
low complexity region 402 410 N/A INTRINSIC
SCOP:d1eq1a_ 441 508 6e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084115
SMART Domains Protein: ENSMUSP00000081132
Gene: ENSMUSG00000039713

DomainStartEndE-ValueType
low complexity region 314 334 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
RhoGEF 410 597 5.21e-53 SMART
PH 655 756 7.35e-12 SMART
low complexity region 778 790 N/A INTRINSIC
low complexity region 895 934 N/A INTRINSIC
low complexity region 1060 1069 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103196
SMART Domains Protein: ENSMUSP00000099485
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 98 135 N/A INTRINSIC
low complexity region 183 207 N/A INTRINSIC
low complexity region 220 229 N/A INTRINSIC
WH2 238 255 4.82e-3 SMART
low complexity region 283 297 N/A INTRINSIC
low complexity region 309 317 N/A INTRINSIC
SCOP:d1eq1a_ 348 415 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105653
SMART Domains Protein: ENSMUSP00000101278
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 28 52 N/A INTRINSIC
low complexity region 65 74 N/A INTRINSIC
WH2 83 100 4.82e-3 SMART
low complexity region 128 142 N/A INTRINSIC
low complexity region 154 162 N/A INTRINSIC
coiled coil region 186 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105654
SMART Domains Protein: ENSMUSP00000101279
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 98 135 N/A INTRINSIC
low complexity region 264 288 N/A INTRINSIC
low complexity region 301 310 N/A INTRINSIC
WH2 319 336 4.82e-3 SMART
low complexity region 364 378 N/A INTRINSIC
low complexity region 390 398 N/A INTRINSIC
SCOP:d1eq1a_ 429 496 6e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105655
SMART Domains Protein: ENSMUSP00000101280
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 98 135 N/A INTRINSIC
low complexity region 183 207 N/A INTRINSIC
WH2 247 264 4.82e-3 SMART
low complexity region 292 306 N/A INTRINSIC
low complexity region 318 326 N/A INTRINSIC
SCOP:d1eq1a_ 357 424 3e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105656
SMART Domains Protein: ENSMUSP00000101281
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 98 135 N/A INTRINSIC
low complexity region 264 288 N/A INTRINSIC
WH2 328 345 4.82e-3 SMART
low complexity region 373 387 N/A INTRINSIC
low complexity region 399 407 N/A INTRINSIC
SCOP:d1eq1a_ 438 505 8e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105657
SMART Domains Protein: ENSMUSP00000101282
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 101 138 N/A INTRINSIC
low complexity region 186 210 N/A INTRINSIC
low complexity region 223 232 N/A INTRINSIC
WH2 241 258 4.82e-3 SMART
low complexity region 286 300 N/A INTRINSIC
low complexity region 312 320 N/A INTRINSIC
SCOP:d1eq1a_ 351 418 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105658
SMART Domains Protein: ENSMUSP00000101283
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
ANK 35 64 3.26e0 SMART
ANK 69 99 1.15e0 SMART
ANK 103 133 2.58e-3 SMART
ANK 137 167 1.63e0 SMART
ANK 171 201 4.97e-5 SMART
ANK 205 235 3.08e-1 SMART
ANK 239 268 9.13e-4 SMART
ANK 271 300 2.15e0 SMART
ANK 304 334 2.08e3 SMART
low complexity region 377 395 N/A INTRINSIC
low complexity region 425 462 N/A INTRINSIC
low complexity region 591 615 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
WH2 646 663 4.82e-3 SMART
low complexity region 691 705 N/A INTRINSIC
low complexity region 717 725 N/A INTRINSIC
coiled coil region 749 825 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105659
SMART Domains Protein: ENSMUSP00000101284
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
ANK 35 64 3.26e0 SMART
ANK 69 99 1.15e0 SMART
ANK 103 133 2.58e-3 SMART
ANK 137 167 1.63e0 SMART
ANK 171 201 4.97e-5 SMART
ANK 205 235 3.08e-1 SMART
ANK 239 268 9.13e-4 SMART
ANK 271 300 2.15e0 SMART
ANK 304 334 2.08e3 SMART
low complexity region 377 395 N/A INTRINSIC
low complexity region 428 465 N/A INTRINSIC
low complexity region 624 648 N/A INTRINSIC
low complexity region 661 670 N/A INTRINSIC
WH2 679 696 4.82e-3 SMART
low complexity region 724 738 N/A INTRINSIC
low complexity region 750 758 N/A INTRINSIC
coiled coil region 782 858 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105661
SMART Domains Protein: ENSMUSP00000101286
Gene: ENSMUSG00000039713

DomainStartEndE-ValueType
low complexity region 314 334 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
RhoGEF 410 597 5.21e-53 SMART
PH 655 756 7.35e-12 SMART
low complexity region 778 790 N/A INTRINSIC
low complexity region 895 934 N/A INTRINSIC
low complexity region 1060 1069 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105662
SMART Domains Protein: ENSMUSP00000101287
Gene: ENSMUSG00000039713

DomainStartEndE-ValueType
low complexity region 282 302 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
RhoGEF 378 565 5.21e-53 SMART
PH 623 724 7.35e-12 SMART
low complexity region 746 758 N/A INTRINSIC
low complexity region 863 902 N/A INTRINSIC
low complexity region 1028 1037 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118648
SMART Domains Protein: ENSMUSP00000112707
Gene: ENSMUSG00000039713

DomainStartEndE-ValueType
low complexity region 301 321 N/A INTRINSIC
low complexity region 356 367 N/A INTRINSIC
RhoGEF 397 584 5.21e-53 SMART
PH 642 743 7.35e-12 SMART
low complexity region 765 777 N/A INTRINSIC
low complexity region 882 921 N/A INTRINSIC
low complexity region 1047 1056 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153619
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156517
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is expressed preferentially in the tissues enriched in lymphocytes, and it may play a role in regulating lymphocyte homeostasis. This receptor has been shown to stimulate NF-kappa B activity and regulate cell apoptosis. The signal transduction of this receptor is mediated by various death domain containing adaptor proteins. Knockout studies in mice suggested the role of this gene in the removal of self-reactive T cells in the thymus. Multiple alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported, most of which are potentially secreted molecules. The alternative splicing of this gene in B and T cells encounters a programmed change upon T-cell activation, which predominantly produces full-length, membrane bound isoforms, and is thought to be involved in controlling lymphocyte proliferation induced by T-cell activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice show no developmental defects or impairments of early thymocyte development. Negative selection and anti-CD3-induced apoptosis, however, are significantly impaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,151,955 I423V probably benign Het
Abl2 T C 1: 156,630,082 V306A possibly damaging Het
Adcy4 T C 14: 55,769,443 Y1006C probably damaging Het
Adprhl1 T C 8: 13,246,114 K144E probably benign Het
Arid5b T C 10: 68,096,689 R885G probably damaging Het
Atp9a A T 2: 168,661,933 V613E probably damaging Het
Atxn7l1 G T 12: 33,194,887 probably benign Het
Brd8 C A 18: 34,623,444 probably benign Het
Bsnd C T 4: 106,486,671 R146H probably benign Het
C4b C T 17: 34,728,864 R1659H probably damaging Het
Duox1 G A 2: 122,337,634 R1080H probably benign Het
Eml2 T C 7: 19,182,401 probably null Het
Fbxo44 G A 4: 148,153,608 R221C probably damaging Het
Frem1 T C 4: 82,963,244 D166G probably damaging Het
Galnt5 T C 2: 57,999,195 L269P probably benign Het
Gigyf2 A G 1: 87,436,860 E954G probably damaging Het
Gpc6 T C 14: 117,951,178 V408A probably benign Het
Hspg2 A G 4: 137,562,224 T3832A probably benign Het
Ift88 A G 14: 57,477,979 N493S probably damaging Het
Ighv1-76 A T 12: 115,848,111 C41S probably damaging Het
Igkv12-46 G A 6: 69,764,946 T16I probably benign Het
Igkv3-9 G T 6: 70,588,563 V49F probably damaging Het
Isoc2b A T 7: 4,849,434 probably benign Het
Lcp2 T A 11: 34,087,173 probably benign Het
Lmntd1 A G 6: 145,427,277 probably null Het
Mdm2 A T 10: 117,709,789 probably null Het
Mrgprx3-ps T C 7: 47,309,998 noncoding transcript Het
Msh2 T C 17: 87,717,604 S637P probably damaging Het
Myo5b T C 18: 74,698,274 F765S possibly damaging Het
Nav2 T A 7: 49,398,109 N91K probably benign Het
Ndor1 G A 2: 25,248,480 P363S probably benign Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Pcdhb5 T C 18: 37,321,997 S477P possibly damaging Het
Pde3b GTGATGATGATGATGATGATGATGATG GTGATGATGATGATGATGATGATG 7: 114,534,749 probably benign Het
Pnpla7 G A 2: 25,051,704 W13* probably null Het
Pnpla8 T C 12: 44,283,442 V41A probably benign Het
Prdm2 A T 4: 143,133,670 S1017T probably benign Het
Prdm5 T A 6: 65,901,787 Y108* probably null Het
Rab34 T A 11: 78,188,766 probably null Het
Smpd5 G T 15: 76,294,912 R160L possibly damaging Het
Srrm2 A G 17: 23,810,468 probably benign Het
Taf5 T A 19: 47,071,014 V199D probably damaging Het
Tas2r114 C T 6: 131,689,622 V148I probably benign Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tex43 A G 18: 56,594,648 T65A probably benign Het
Tpd52l1 T C 10: 31,379,319 T11A possibly damaging Het
Trmt1l G A 1: 151,452,154 E472K probably benign Het
Ttc17 T C 2: 94,342,753 K766E probably damaging Het
Ttc37 A G 13: 76,127,504 E410G possibly damaging Het
Ttn C T 2: 76,730,289 R29256Q probably damaging Het
Ttn T C 2: 76,742,070 I26160V probably damaging Het
Ubxn6 A T 17: 56,069,303 V311E probably damaging Het
Usp2 T C 9: 44,091,063 S351P probably damaging Het
Usp7 C A 16: 8,708,914 D187Y probably damaging Het
Vmn1r115 C T 7: 20,844,282 R235K probably benign Het
Vmn2r50 A C 7: 10,050,308 F80V probably damaging Het
Vmn2r58 T A 7: 41,861,936 K481M possibly damaging Het
Vmn2r86 A G 10: 130,452,600 I344T possibly damaging Het
Zfp455 A T 13: 67,207,325 N219I probably damaging Het
Other mutations in Tnfrsf25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Tnfrsf25 APN 4 152118428 missense probably benign 0.01
IGL02324:Tnfrsf25 APN 4 152119322 missense probably damaging 0.98
IGL03143:Tnfrsf25 APN 4 152116927 unclassified probably benign
hatikva UTSW 4 152119627 unclassified probably null
R0103:Tnfrsf25 UTSW 4 152116948 missense possibly damaging 0.62
R0103:Tnfrsf25 UTSW 4 152116948 missense possibly damaging 0.62
R1067:Tnfrsf25 UTSW 4 152118288 missense probably damaging 1.00
R1729:Tnfrsf25 UTSW 4 152118304 critical splice donor site probably null
R1784:Tnfrsf25 UTSW 4 152118304 critical splice donor site probably null
R1799:Tnfrsf25 UTSW 4 152117008 missense probably benign 0.00
R4003:Tnfrsf25 UTSW 4 152119601 missense probably damaging 0.98
R4151:Tnfrsf25 UTSW 4 152119801 missense probably damaging 0.99
R4997:Tnfrsf25 UTSW 4 152117696 critical splice donor site probably null
R6436:Tnfrsf25 UTSW 4 152119627 unclassified probably null
RF009:Tnfrsf25 UTSW 4 152119624 missense probably damaging 1.00
X0018:Tnfrsf25 UTSW 4 152116978 missense probably damaging 1.00
Z1176:Tnfrsf25 UTSW 4 152119221 missense probably benign 0.19
Z1177:Tnfrsf25 UTSW 4 152117639 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACTTAGGGAGCGTTCTGATG -3'
(R):5'- CCTTCTGCATCAAGTTACGGG -3'

Sequencing Primer
(F):5'- AAGGTATCGGGCAGTCCTG -3'
(R):5'- CATCAAGTTACGGGGGCTCTAGAC -3'
Posted On2015-07-07