Mutagenetix > Incidental Mutations

Incidental Mutation 'R4411:Tas2r114'

327909

Institutional Source

Beutler Lab

Gene Symbol

Tas2r114

Ensembl Gene

ENSMUSG00000063478

Gene Name

taste receptor, type 2, member 114

Synonyms

mt2r46, mGR14, T2R14, Tas2r14

MMRRC Submission

041693-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.059) question?

Stock #

R4411 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

131689134-131690063 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 131689622 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 148 (V148I)

Ref Sequence

ENSEMBL: ENSMUSP00000079453 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053652] [ENSMUST00000072404] [ENSMUST00000080619]

Predicted Effect

probably benign
Transcript: ENSMUST00000053652

SMART Domains

Protein: ENSMUSP00000058006
Gene: ENSMUSG00000051153

Domain	Start	End	E-Value	Type
Pfam:TAS2R	1	298	9.4e-109	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000072404

SMART Domains

Protein: ENSMUSP00000072237
Gene: ENSMUSG00000061977

Domain	Start	End	E-Value	Type
Pfam:TAS2R	1	298	8.3e-102	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000080619
AA Change: V148I

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000079453
Gene: ENSMUSG00000063478
AA Change: V148I

Domain	Start	End	E-Value	Type
Pfam:TAS2R	1	298	8.1e-104	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

95% (62/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the family of candidate taste receptors that are members of the G-protein-coupled receptor superfamily. These proteins are specifically expressed in the taste receptor cells of the tongue and palate epithelia. They are organized in the genome in clusters and are genetically linked to loci that influence bitter perception in mice and humans. In functional expression studies, they respond to bitter tastants. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	T	C	11: 110,151,955	I423V	probably benign	Het
Abl2	T	C	1: 156,630,082	V306A	possibly damaging	Het
Adcy4	T	C	14: 55,769,443	Y1006C	probably damaging	Het
Adprhl1	T	C	8: 13,246,114	K144E	probably benign	Het
Arid5b	T	C	10: 68,096,689	R885G	probably damaging	Het
Atp9a	A	T	2: 168,661,933	V613E	probably damaging	Het
Atxn7l1	G	T	12: 33,194,887		probably benign	Het
Brd8	C	A	18: 34,623,444		probably benign	Het
Bsnd	C	T	4: 106,486,671	R146H	probably benign	Het
C4b	C	T	17: 34,728,864	R1659H	probably damaging	Het
Duox1	G	A	2: 122,337,634	R1080H	probably benign	Het
Eml2	T	C	7: 19,182,401		probably null	Het
Fbxo44	G	A	4: 148,153,608	R221C	probably damaging	Het
Frem1	T	C	4: 82,963,244	D166G	probably damaging	Het
Galnt5	T	C	2: 57,999,195	L269P	probably benign	Het
Gigyf2	A	G	1: 87,436,860	E954G	probably damaging	Het
Gpc6	T	C	14: 117,951,178	V408A	probably benign	Het
Hspg2	A	G	4: 137,562,224	T3832A	probably benign	Het
Ift88	A	G	14: 57,477,979	N493S	probably damaging	Het
Ighv1-76	A	T	12: 115,848,111	C41S	probably damaging	Het
Igkv12-46	G	A	6: 69,764,946	T16I	probably benign	Het
Igkv3-9	G	T	6: 70,588,563	V49F	probably damaging	Het
Isoc2b	A	T	7: 4,849,434		probably benign	Het
Lcp2	T	A	11: 34,087,173		probably benign	Het
Lmntd1	A	G	6: 145,427,277		probably null	Het
Mdm2	A	T	10: 117,709,789		probably null	Het
Mrgprx3-ps	T	C	7: 47,309,998		noncoding transcript	Het
Msh2	T	C	17: 87,717,604	S637P	probably damaging	Het
Myo5b	T	C	18: 74,698,274	F765S	possibly damaging	Het
Nav2	T	A	7: 49,398,109	N91K	probably benign	Het
Ndor1	G	A	2: 25,248,480	P363S	probably benign	Het
Npr3	G	C	15: 11,905,149	T164R	probably benign	Het
Pcdhb5	T	C	18: 37,321,997	S477P	possibly damaging	Het
Pde3b	GTGATGATGATGATGATGATGATGATG	GTGATGATGATGATGATGATGATG	7: 114,534,749		probably benign	Het
Pnpla7	G	A	2: 25,051,704	W13*	probably null	Het
Pnpla8	T	C	12: 44,283,442	V41A	probably benign	Het
Prdm2	A	T	4: 143,133,670	S1017T	probably benign	Het
Prdm5	T	A	6: 65,901,787	Y108*	probably null	Het
Rab34	T	A	11: 78,188,766		probably null	Het
Smpd5	G	T	15: 76,294,912	R160L	possibly damaging	Het
Srrm2	A	G	17: 23,810,468		probably benign	Het
Taf5	T	A	19: 47,071,014	V199D	probably damaging	Het
Tas2r136	C	A	6: 132,778,009	V52L	probably damaging	Het
Tex43	A	G	18: 56,594,648	T65A	probably benign	Het
Tnfrsf25	G	A	4: 152,118,386		probably benign	Het
Tpd52l1	T	C	10: 31,379,319	T11A	possibly damaging	Het
Trmt1l	G	A	1: 151,452,154	E472K	probably benign	Het
Ttc17	T	C	2: 94,342,753	K766E	probably damaging	Het
Ttc37	A	G	13: 76,127,504	E410G	possibly damaging	Het
Ttn	C	T	2: 76,730,289	R29256Q	probably damaging	Het
Ttn	T	C	2: 76,742,070	I26160V	probably damaging	Het
Ubxn6	A	T	17: 56,069,303	V311E	probably damaging	Het
Usp2	T	C	9: 44,091,063	S351P	probably damaging	Het
Usp7	C	A	16: 8,708,914	D187Y	probably damaging	Het
Vmn1r115	C	T	7: 20,844,282	R235K	probably benign	Het
Vmn2r50	A	C	7: 10,050,308	F80V	probably damaging	Het
Vmn2r58	T	A	7: 41,861,936	K481M	possibly damaging	Het
Vmn2r86	A	G	10: 130,452,600	I344T	possibly damaging	Het
Zfp455	A	T	13: 67,207,325	N219I	probably damaging	Het

Other mutations in Tas2r114

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01777:Tas2r114	APN	6	131689701	nonsense	probably null
IGL02971:Tas2r114	APN	6	131689280	missense	probably benign	0.00
R0561:Tas2r114	UTSW	6	131689795	missense	probably benign	0.30
R3034:Tas2r114	UTSW	6	131689648	missense	probably benign	0.15
R3687:Tas2r114	UTSW	6	131689268	missense	probably benign	0.25
R4826:Tas2r114	UTSW	6	131689837	missense	probably damaging	0.99
R4889:Tas2r114	UTSW	6	131689795	missense	probably damaging	0.96
R5084:Tas2r114	UTSW	6	131689288	nonsense	probably null
R5258:Tas2r114	UTSW	6	131689541	missense	probably benign	0.03
R6038:Tas2r114	UTSW	6	131689481	missense	possibly damaging	0.89
R6038:Tas2r114	UTSW	6	131689481	missense	possibly damaging	0.89
R6499:Tas2r114	UTSW	6	131689136	makesense	probably null
R7164:Tas2r114	UTSW	6	131689765	missense	possibly damaging	0.74
R7276:Tas2r114	UTSW	6	131689347	missense	probably damaging	0.96
R7745:Tas2r114	UTSW	6	131689438	missense	probably damaging	1.00
R7851:Tas2r114	UTSW	6	131689925	missense	probably damaging	1.00
R7934:Tas2r114	UTSW	6	131689925	missense	probably damaging	1.00
R8002:Tas2r114	UTSW	6	131689139	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGATTCCATCTGCCTGCGATG -3'
(R):5'- GCTGTCTCCTGTCAACATAATTG -3'

Sequencing Primer
(F):5'- CCTGCGATGTCTCCAAAGTGAAATG -3'
(R):5'- GGTTTGCCACTAGTCTCA -3'

Posted On

2015-07-07