Incidental Mutation 'R4411:Tas2r114'
ID 327909
Institutional Source Beutler Lab
Gene Symbol Tas2r114
Ensembl Gene ENSMUSG00000063478
Gene Name taste receptor, type 2, member 114
Synonyms mt2r46, mGR14, T2R14, Tas2r14
MMRRC Submission 041693-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock # R4411 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 131689134-131690063 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 131689622 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 148 (V148I)
Ref Sequence ENSEMBL: ENSMUSP00000079453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053652] [ENSMUST00000072404] [ENSMUST00000080619]
AlphaFold Q7M722
Predicted Effect probably benign
Transcript: ENSMUST00000053652
SMART Domains Protein: ENSMUSP00000058006
Gene: ENSMUSG00000051153

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 9.4e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072404
SMART Domains Protein: ENSMUSP00000072237
Gene: ENSMUSG00000061977

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 8.3e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080619
AA Change: V148I

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000079453
Gene: ENSMUSG00000063478
AA Change: V148I

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 8.1e-104 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the family of candidate taste receptors that are members of the G-protein-coupled receptor superfamily. These proteins are specifically expressed in the taste receptor cells of the tongue and palate epithelia. They are organized in the genome in clusters and are genetically linked to loci that influence bitter perception in mice and humans. In functional expression studies, they respond to bitter tastants. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,151,955 I423V probably benign Het
Abl2 T C 1: 156,630,082 V306A possibly damaging Het
Adcy4 T C 14: 55,769,443 Y1006C probably damaging Het
Adprhl1 T C 8: 13,246,114 K144E probably benign Het
Arid5b T C 10: 68,096,689 R885G probably damaging Het
Atp9a A T 2: 168,661,933 V613E probably damaging Het
Atxn7l1 G T 12: 33,194,887 probably benign Het
Brd8 C A 18: 34,623,444 probably benign Het
Bsnd C T 4: 106,486,671 R146H probably benign Het
C4b C T 17: 34,728,864 R1659H probably damaging Het
Duox1 G A 2: 122,337,634 R1080H probably benign Het
Eml2 T C 7: 19,182,401 probably null Het
Fbxo44 G A 4: 148,153,608 R221C probably damaging Het
Frem1 T C 4: 82,963,244 D166G probably damaging Het
Galnt5 T C 2: 57,999,195 L269P probably benign Het
Gigyf2 A G 1: 87,436,860 E954G probably damaging Het
Gpc6 T C 14: 117,951,178 V408A probably benign Het
Hspg2 A G 4: 137,562,224 T3832A probably benign Het
Ift88 A G 14: 57,477,979 N493S probably damaging Het
Ighv1-76 A T 12: 115,848,111 C41S probably damaging Het
Igkv12-46 G A 6: 69,764,946 T16I probably benign Het
Igkv3-9 G T 6: 70,588,563 V49F probably damaging Het
Isoc2b A T 7: 4,849,434 probably benign Het
Lcp2 T A 11: 34,087,173 probably benign Het
Lmntd1 A G 6: 145,427,277 probably null Het
Mdm2 A T 10: 117,709,789 probably null Het
Mrgprx3-ps T C 7: 47,309,998 noncoding transcript Het
Msh2 T C 17: 87,717,604 S637P probably damaging Het
Myo5b T C 18: 74,698,274 F765S possibly damaging Het
Nav2 T A 7: 49,398,109 N91K probably benign Het
Ndor1 G A 2: 25,248,480 P363S probably benign Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Pcdhb5 T C 18: 37,321,997 S477P possibly damaging Het
Pde3b GTGATGATGATGATGATGATGATGATG GTGATGATGATGATGATGATGATG 7: 114,534,749 probably benign Het
Pnpla7 G A 2: 25,051,704 W13* probably null Het
Pnpla8 T C 12: 44,283,442 V41A probably benign Het
Prdm2 A T 4: 143,133,670 S1017T probably benign Het
Prdm5 T A 6: 65,901,787 Y108* probably null Het
Rab34 T A 11: 78,188,766 probably null Het
Smpd5 G T 15: 76,294,912 R160L possibly damaging Het
Srrm2 A G 17: 23,810,468 probably benign Het
Taf5 T A 19: 47,071,014 V199D probably damaging Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tex43 A G 18: 56,594,648 T65A probably benign Het
Tnfrsf25 G A 4: 152,118,386 probably benign Het
Tpd52l1 T C 10: 31,379,319 T11A possibly damaging Het
Trmt1l G A 1: 151,452,154 E472K probably benign Het
Ttc17 T C 2: 94,342,753 K766E probably damaging Het
Ttc37 A G 13: 76,127,504 E410G possibly damaging Het
Ttn C T 2: 76,730,289 R29256Q probably damaging Het
Ttn T C 2: 76,742,070 I26160V probably damaging Het
Ubxn6 A T 17: 56,069,303 V311E probably damaging Het
Usp2 T C 9: 44,091,063 S351P probably damaging Het
Usp7 C A 16: 8,708,914 D187Y probably damaging Het
Vmn1r115 C T 7: 20,844,282 R235K probably benign Het
Vmn2r50 A C 7: 10,050,308 F80V probably damaging Het
Vmn2r58 T A 7: 41,861,936 K481M possibly damaging Het
Vmn2r86 A G 10: 130,452,600 I344T possibly damaging Het
Zfp455 A T 13: 67,207,325 N219I probably damaging Het
Other mutations in Tas2r114
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01777:Tas2r114 APN 6 131689701 nonsense probably null
IGL02971:Tas2r114 APN 6 131689280 missense probably benign 0.00
R0561:Tas2r114 UTSW 6 131689795 missense probably benign 0.30
R3034:Tas2r114 UTSW 6 131689648 missense probably benign 0.15
R3687:Tas2r114 UTSW 6 131689268 missense probably benign 0.25
R4826:Tas2r114 UTSW 6 131689837 missense probably damaging 0.99
R4889:Tas2r114 UTSW 6 131689795 missense probably damaging 0.96
R5084:Tas2r114 UTSW 6 131689288 nonsense probably null
R5258:Tas2r114 UTSW 6 131689541 missense probably benign 0.03
R6038:Tas2r114 UTSW 6 131689481 missense possibly damaging 0.89
R6038:Tas2r114 UTSW 6 131689481 missense possibly damaging 0.89
R6499:Tas2r114 UTSW 6 131689136 makesense probably null
R7164:Tas2r114 UTSW 6 131689765 missense possibly damaging 0.74
R7276:Tas2r114 UTSW 6 131689347 missense probably damaging 0.96
R7745:Tas2r114 UTSW 6 131689438 missense probably damaging 1.00
R7851:Tas2r114 UTSW 6 131689925 missense probably damaging 1.00
R8002:Tas2r114 UTSW 6 131689139 missense probably damaging 1.00
R8901:Tas2r114 UTSW 6 131689951 missense probably damaging 0.99
R9297:Tas2r114 UTSW 6 131689324 missense probably damaging 0.96
R9380:Tas2r114 UTSW 6 131689418 missense probably benign 0.00
R9402:Tas2r114 UTSW 6 131689931 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- TGATTCCATCTGCCTGCGATG -3'
(R):5'- GCTGTCTCCTGTCAACATAATTG -3'

Sequencing Primer
(F):5'- CCTGCGATGTCTCCAAAGTGAAATG -3'
(R):5'- GGTTTGCCACTAGTCTCA -3'
Posted On 2015-07-07